Solidago riddellii

Frank · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records1 483

Data sources11

Biological traits13

DNA specimens19

eDNA detections12

Sources11 archives

Databases and archives Solidago riddellii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 483 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 483 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD · NCBI19 specimens

Genome at a glanceCCDB826 Mbp

01Narrative

Solidago riddellii, known as Riddell's goldenrod, is a North American plant species in the genus Solidago of the family Asteraceae. It grows primarily in the Great Lakes and eastern Great Plains of Canada and the United States. It is sometimes considered part of the genus Oligoneuron, but as a Solidago, included in the section Solidago sect. Ptarmicoidei, the flat-topped goldenrods.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.2 mg

Seed mass max0.2 mg

Seed mass min0.2 mg

Life cycle & reproduction3

Flowering endOct

Flowering startSep

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago riddellii has left across the world's sequence archives.

At a glance

DNA specimens19

Marker genes5

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219144.1 ↗339 bpCanada · 1958

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago riddellii voucher CCDB-22991-A04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago riddellii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size826 410 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Solidago riddellii0.83 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 188×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3

CCDB · book-ipcn65 — Blume in L. & B. 1959

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

CCDB · ipcn-api-dl — Pringle, J. S. 1979. Documented plant chromosome numbers 1979: 1. Sida 8: 119–120.

CCDB · book-ipcn66 — Kapoor & Beaudry 1966

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.

CCDB · eflora

CCDB · Cave1963 — Beaudry 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 483 records

Wild obs. + sensor814

Museum / vouchered668

Cultivated / captive1

Origin

Native4

Range

Area of Occupancy AOO3 448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 399≤1 km 77≤10 km 13>10 km 119

608 georeferenced · 206 without coordinates

Open the mapobservation + sensor814

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 17≤1 km 149≤10 km 121>10 km 27

314 georeferenced · 354 without coordinates

Open the institutions mapphysical evidence668

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	111
Chicago, US	104
Oregon State Universitylocation not on record	71
Bronx, US	71
Madison, US	63
Ann Arbor, US	44
Bloomington, US	43
Saint Louis, US	24
WINlocation not on record	22
Montréal, CA	13
Philadelphia, US	12
McWane Science Centerlocation not on record	11
Wuzhou, CN	7
Mount Pleasant, US	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Dekalb, US	5
Chicago, US	5
Whitewater, US	5
Chongqing Museumlocation not on record	5
Davenport, US	4
Green Bay, US	4
Burlington, US	3
Museum of the Rockieslocation not on record	3
Bangkok, TH	3
Little Rock, US	2
Staten Island, US	2
Québec, CA	2
University of Alberta Museumslocation not on record	2
CJBGlocation not on record	1
Moscow State Universitylocation not on record	1
University of Stellenboschlocation not on record	1
Brookings, US	1
Spearfish, US	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Denver, US	1
GB	1
US	1
Boise, US	1
Jena Microbial Resource Collectionlocation not on record	1
Flagstaff, US	1
Toronto, CA	1

41 institutions · 664 of 668 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Solidago riddellii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

Along the river front roadWet sandy soil

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 16.1–16.1

Seasonal swing summer↔winter41.0 °C

Max temp (day)19.6 °C

Min temp (night)13.6 °C

Precipitation122 mm/mo

Air humidity57.4 %

Moisture balance-26.1 mm/mo

Vapour deficit779 Pa

Wind speed5.50 m/s

Cloud cover43.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Solidago riddellii

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 483 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions29 of 41 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 483 records