Solidago ohioensis

Riddell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records1 497

Data sources12

Biological traits11

DNA specimens20

eDNA detections11

Sources12 archives

Databases and archives Solidago ohioensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 497 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 497 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Solidago ohioensis is a North American plant species in the family Asteraceae, called the Ohio goldenrod. It is found primarily in the Great Lakes region of Canada and the United States, in Ontario, New York, Ohio, Michigan, Wisconsin, Indiana, and Illinois.Biota of North America Program 2014 county distribution map Solidago ohioensis is a perennial herb up to 100 cm (39 inches) tall. The leaves are narrow, up to 25 cm (10 inches) long. One plant can produce as many as 500 small yellow flower heads in a compact branching array at the top of the plant. The plant grows in marshes, on sand dunes, and along the banks of rivers.Flora of North America, Solidago ohioensis Riddell, 1835. Ohio goldenrod

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.212 mg

Seed mass max0.216 mg

Seed mass min0.21 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago ohioensis has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences10

eDNA detections11

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG220035.1 ↗339 bpCanada · 1951

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago ohioensis voucher CCDB-22991-C05 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago ohioensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · eflora

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

CCDB · ipcn-api-dl — Pringle, J. S. 1979. Documented plant chromosome numbers 1979: 1. Sida 8: 119–120.

CCDB · book-ipcn66 — Kapoor & Beaudry 1966

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 497 records

Wild obs. + sensor985

Museum / vouchered512

Range

Area of Occupancy AOO2 484 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 399≤1 km 57≤10 km 23>10 km 139

618 georeferenced · 367 without coordinates

Open the mapobservation + sensor985

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 17≤1 km 87≤10 km 98>10 km 10

212 georeferenced · 300 without coordinates

Open the institutions mapphysical evidence512

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Oregon State Universitylocation not on record	72
Montréal, CA	66
Bronx, US	58
Chicago, US	58
Ann Arbor, US	57
Madison, US	41
Bloomington, US	33
Chongqing Museumlocation not on record	24
McWane Science Centerlocation not on record	17
Mount Pleasant, US	16
Philadelphia, US	7
University of Alberta Museumslocation not on record	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Toronto, CA	5
Flagstaff, US	4
Whitewater, US	4
Wuzhou, CN	3
Green Bay, US	3
Bangkok, TH	3
Québec, CA	3
Burlington, US	3
University of Wisconsinlocation not on record	2
Museum of the Rockieslocation not on record	1
Minia, EG	1
Denver, US	1
Saint Louis, US	1
Whitehorse, CA	1
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	1
Davenport, US	1
Boise, US	1
Lord Fairfax Community Collegelocation not on record	1
Chicago, US	1
Bruce Peninsula National Parklocation not on record	1
Ypsilanti, US	1
Cincinnati, US	1
Dekalb, US	1
Kew, GB	1

37 institutions · 504 of 512 vouchered records shown · 8 without an institution code

09Environmental DNA11 detections

Where the DNA of Solidago ohioensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

Moist acid sand of sterile meadowWet meadow of shore of Long Pond.On limestone shores.Open moist sandy soil.Wet calcareous banksMarshy shore of Long Pond close lighthouse

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 17.7–20.0

Seasonal swing summer↔winter27.4 °C

Max temp (day)20.9 °C 20.1–21.8

Min temp (night)17.2 °C 16.0–18.9

Precipitation114 mm/mo 85.2–116

Air humidity60.6 % 60.1–60.9

Moisture balance-18.8 mm/mo -39.7–3.00

Vapour deficit862 Pa 800–920

Wind speed4.50 m/s 2.80–5.90

Cloud cover45.1 % 40.1–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Solidago ohioensis

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 497 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 497 records