Solidago nitida

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records291

Data sources11

Biological traits8

DNA specimens6

eDNA detections6

Sources11 archives

Databases and archives Solidago nitida's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility291 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF291 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Solidago nitida is a North American plant species in the family Asteraceae, common name shiny goldenrod. The species is native to the south-central United States, in the southern Great Plains and Lower Mississippi Valley. It is found in the states of Oklahoma, Texas, Louisiana, Arkansas, and Mississippi.Biota of North America Program 2014 county distribution map Solidago nitida is a perennial herb up to 100 cm (40 inches) tall. Leaves are hairless and shiny, found both at the base of the plant and higher up on the stem. One plant can produce as many as 100 small yellow flower heads in a compact, flat-topped array.Flora of North America, Solidago nitida Torrey & A. Gray, 1842. Shiny goldenrod

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.848 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago nitida has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes2

GenBank sequences6

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSAY170957.1 ↗624 bp

ACGT

TCGAAGCCTGCAAAGCAAAACGACCCGTGAACATGTTATAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCATGGCACACC …

Oligoneuron nitidum RR066 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago nitida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · Cave1963

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

CCDB · eflora

CCDB · Cave1963 — Beaudry 1963

n 92×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · book-ipcn67-71 — JONES, S.B. Jr. 1968. Chromosome numbers in southeastern United states Compositae II. Bull. Torrey Bot. Club 95: 488-489.

CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type291 records

Wild obs. + sensor99

Museum / vouchered192

Range

Area of Occupancy AOO816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 60≤1 km 8>10 km 12

80 georeferenced · 19 without coordinates

Open the mapobservation + sensor99

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 10≤1 km 23≤10 km 60>10 km 11

104 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence192

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	40
Fort Worth, US	26
Wuzhou, CN	18
US	18
Chapel Hill, US	17
Jackson, US	15
Denton, US	12
Chicago, US	11
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	6
Bangkok, TH	5
Chongqing Museumlocation not on record	3
Little Rock, US	3
Stockholm, SE	3
University of Southern Mississippilocation not on record	2
Bloomington, US	2
BAYLUlocation not on record	2
Riverside, US	1
EL PASO, US	1
Emporia, US	1
Moscow, US	1
Jena Microbial Resource Collectionlocation not on record	1
South Kensington, GB	1
Tampa, US	1
Saint Louis, US	1

24 institutions · 191 of 192 vouchered records shown · 1 without an institution code

09Environmental DNA6 detections

Where the DNA of Solidago nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)