Solidago multiradiata
Aiton · speciesAt a glance
Occurrence records5 458
Data sources11
Biological traits79
DNA specimens49
eDNA detections21
Sources11 archives
Databases and archives Solidago multiradiata's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 458 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics49 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources79 traits
Chemical compositionNPASS3 compounds
Occurrence & distributionGBIF5 458 records
Environmental DNA1 datasets · 2 countries21 detections
DNA & barcodingBOLD · NCBI49 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Solidago multiradiata là một loài thực vật có hoa trong họ Cúc. Loài này được Aiton miêu tả khoa học đầu tiên năm 1789.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.3 m
⚠ sources differ — GIFT: 0.3 m · USDA: 0.305 m · TRY: 0.438 m
Seed mass2.29 mg
Seed mass max0.42 mg
Seed mass min0.42 mg
Life cycle & reproduction21
After harvest regrowth rateModerate
Bloom periodLate Summer
Coppice potentialNo
Flower colouryellow
Flower conspicuousYes
Life formperennial
Life spanperennial
Lifespan categoryShort
Lifespan years6 years
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateRapid
Seedling vigorHigh
Habitat & environment22
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsNo
BloatNone
Climatetemperate
Climberself-supporting
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb
Growth form USDASingle Stem
Hedge toleranceLow
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessvariable
Physiology & chemistry15
Anaerobic toleranceLow
C:N ratioMedium
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Frost free days min47 days
Nitrogen fixation levelNone
Precipitation max100 in
Precipitation min10 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7.3 pH
Soil pH min5 pH
Temperature min-62 °F
Uses & economy11
Berry nut seed productNo
Christmas tree productNo
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound108 888 per lb
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr0.61 m
Planting density max20 000 per acre
Planting density min5 120 per acre
03Chemical composition3 compounds
Compounds documented for Solidago multiradiata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Phenylethylamines2
Amarylidaceae alkaloids $ Phenylethylamines1
Documented compounds3 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 3,4-Dimethoxyphenylethylamine | present | NPASS | |
| Magnosprengerine | present | NPASS | |
| N-Methylhomoveratrylamine | present | NPASS |
05DNA & barcoding49 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago multiradiata has left across the world's sequence archives.
At a glance
DNA specimens49
Marker genes7
GenBank sequences10
eDNA detections21
Countries2
The DNA barcodea real sequence read deposited for this species
TGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCA …
Solidago multiradiata isolate LLV81 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL5★rbcLa★trnL-F★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Solidago multiradiata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–362n range18median18mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1814×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +3
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].
CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Semple, J. C. 1981. In Chromosome number reports LXXll. Taxon 30: 703–704.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.
CCDB · book-ipcn73-74 — KOVANDA, M. 1972. Somatic chromosome numbers for some Asteraceae. Rhodora 74: 102-116.
CCDB · book-atlas-flowering-plants
CCDB · Cave1959 — Beaudry & Chabot 1959
CCDB · Cave1963 — Beaudry 1963
2n 365×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.
CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.
CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — PACKER, J.G. 1968. In IOPB chromosome number reports XVII. Taxon 17: 285-288.
n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Semple, J. C. 1981. In Chromosome number reports LXXll. Taxon 30: 703–704.
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
CCDB · book-ipcn67-71 — TAYLOR, R. L. 1967. In IOPB chromosome number reports XIII. Taxon 16: 445-461.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & W.J. CODY. 1971. In IOPB chromosome number reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn73-74 — WITHERSPOON, J.T., C.G. SCHAACK, & T.J. WATSON JR. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
n 92×CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · book-ipcn67-71 — SOLBRIG, Q.T., L.C. ANDERSON, D.W. KYHOS, & P.H. RAVEN. 1969. Chromosome numbers in Compositae. VIII: Astereae III. Amer. J. Bot. 56: 348-353.
CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 458 records
Wild obs. + sensor2 002
Museum / vouchered3 448
Cultivated / captive8
Origin
Native61
Introduced1
Range
Area of Occupancy AOO13 868 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 1 104≤1 km 200≤10 km 86>10 km 56
1 446 georeferenced · 556 without coordinates
Open the mapobservation + sensor2 002
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 183≤1 km 475≤10 km 540>10 km 67
1 265 georeferenced · 2 183 without coordinates
Open the institutions mapphysical evidence3 448
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy88% within 1 km
≤100 m 2≤1 km 5≤10 km 1
8 georeferenced
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions83 of 124 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 347 |
| University of Alberta Museumslocation not on record | 202 |
| Vancouver, CA | 189 |
| Bronx, US | 187 |
| Chicago, US | 137 |
| Victoria, CA | 132 |
| WTUlocation not on record | 126 |
| Université Lavallocation not on record | 119 |
| Moscow, US | 117 |
| Québec, CA | 100 |
| Provo, US | 100 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 97 |
| Montréal, CA | 76 |
| Missoula, US | 72 |
| Corvallis, US | 71 |
| Claremont, US | 69 |
| Pullman, US | 68 |
| Stockholm, SE | 58 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 56 |
| Boise, US | 54 |
| University of Stellenboschlocation not on record | 52 |
| Flagstaff, US | 49 |
| Denver, US | 42 |
| Anchorage, US | 38 |
| Yukon Universitylocation not on record | 33 |
| Chongqing Museumlocation not on record | 32 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 30 |
| Davis, US | 27 |
| WINlocation not on record | 27 |
| Angwin, US | 24 |
| Rocky Mountain Biological Laboratorylocation not on record | 24 |
| Riverside, US | 24 |
| Bozeman, US | 24 |
| Orem, US | 23 |
| St. Paul, US | 22 |
| Montréal, CA | 20 |
| Pocatello, US | 19 |
| Logan, US | 19 |
| Arcata, US | 18 |
| Bloomington, US | 18 |
| Santa Barbara, US | 17 |
| ASUlocation not on record | 16 |
| Wuzhou, CN | 16 |
| University of Lethbridgelocation not on record | 16 |
| Caldwell, US | 15 |
| Whitehorse, CA | 14 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 13 |
| Phoenix, US | 13 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 11 |
| CASlocation not on record | 11 |
| Durango, US | 11 |
| Northridge, US | 10 |
| Los Angeles, US | 10 |
| Acadia Universitylocation not on record | 9 |
| Uppsala, SE | 7 |
| Trois-Rivières, CA | 7 |
| Madison, US | 7 |
| Churchill Northern Studies Centrelocation not on record | 7 |
| Pittsburg, US | 6 |
| INFlocation not on record | 6 |
| US | 6 |
| MeiseBGlocation not on record | 6 |
| BRNUlocation not on record | 6 |
| Chadron, US | 6 |
| Philadelphia, US | 6 |
| Tempe, US | 5 |
| Saint Louis, US | 5 |
| KNFYlocation not on record | 5 |
| Canadian Museum of Naturelocation not on record | 5 |
| Olocation not on record | 4 |
| Albuquerque, US | 4 |
| Tacoma, US | 4 |
| Toronto, CA | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| San Luis Obispo, US | 4 |
| Moscow State Universitylocation not on record | 4 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Henderson, US | 3 |
| US | 3 |
| Saint John, CA | 3 |
| USFSlocation not on record | 3 |
| Yellowstone National Park Herbariumlocation not on record | 3 |
| Mississippi State, US | 3 |
| Cheney, US | 3 |
| San Francisco, US | 3 |
| Emporia, US | 2 |
| Portland, US | 2 |
| Long Beach, US | 2 |
| Columbia, US | 2 |
| Burlington, US | 2 |
| Durham, US | 2 |
| San Jose, US | 2 |
| Bangkok, TH | 2 |
| GB | 2 |
| STNFlocation not on record | 2 |
| Grand Junction, US | 2 |
| US | 1 |
| Austin, US | 1 |
| Dover, US | 1 |
| AUAlocation not on record | 1 |
| Bourges, FR | 1 |
| Truckee, US | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| KNFSClocation not on record | 1 |
| Cambridge, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Paris, FR | 1 |
| San Diego, US | 1 |
| Göteborg, SE | 1 |
| Trondheim, NO | 1 |
| Davenport, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| McGill University, Department of Biologylocation not on record | 1 |
| New Brunswick, US | 1 |
| Lincoln, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Macomb, US | 1 |
| Whitewater, US | 1 |
| Dekalb, US | 1 |
| New Haven, US | 1 |
| TROMlocation not on record | 1 |
| Millersville, US | 1 |
124 institutions · 3 319 of 3 448 vouchered records shown · 129 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Solidago multiradiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map2 countries0
Mesic Medium Shrub on slope of S aspectGround Squirrel colony, slightly elevated du…Dry slope with rock outcropsAlpine tundraBig meadow mixed with wet pockets
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.4 °C 4.50–12.9
Seasonal swing summer↔winter37.0 °C
Max temp (day)14.6 °C 7.90–19.2
Min temp (night)7.10 °C -0.4–7.60
Precipitation89.7 mm/mo 60.0–131
Air humidity61.6 % 48.5–67.2
Moisture balance-9.00 mm/mo -45.2–37.8
Vapour deficit485 Pa 286–685
Wind speed2.90 m/s 2.20–4.20
Cloud cover44.2 % 30.6–73.3
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.