Solidago missouriensis
Nutt. · speciesAt a glance
Occurrence records4 192
Data sources13
Biological traits101
DNA specimens8
eDNA detections4
Sources13 archives
Databases and archives Solidago missouriensis's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 192 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources101 traits
Chemical compositionLOTUS · NPASS23 compounds
Occurrence & distributionGBIF4 192 records
Environmental DNA1 datasets · 2 countries4 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Solidago missouriensis is a species of flowering plant in the family Asteraceae known by the common names Missouri goldenrod and prairie goldenrod. It is native to North America, where it is widespread across much of Canada, the United States, and northern Mexico. It grows from British Columbia east to Manitoba, south as far as Sonora, Coahuila, Texas, and Mississippi.SEINet, Southwest Biodiversity, Arizona Chapter, Solidago missouriensis Nutt. includes photos, description, partial distribution map
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.91 m
⚠ sources differ — GIFT: 0.91 m · USDA: 0.914 m · TRY: 0.245 m
Seed mass0.33 mg
⚠ sources differ — TRY: 0.33 mg · GIFT: 0.276 mg
Seed mass max0.49 mg
Seed mass min0.16 mg
Life cycle & reproduction27
After harvest regrowth rateSlow
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessdeciduous
Flower colouryellow
Flower conspicuousYes
Flowering endSep
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min90 days
Leaf c472 mg/g
Leaf dry-matter content (LDMC)317 mg/g
Leaf n11.8 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max35 in
Precipitation min12 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceMedium
Soil pH max7.5 pH
Soil pH min5.5 pH
Specific leaf area (SLA)13.85 mm²/mg
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 998 238 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max2 700 per acre
Planting density min1 700 per acre
03Chemical composition23 compounds
Compounds documented for Solidago missouriensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Colensane and Clerodane diterpenoids7
Abietane diterpenoids6
Kaurane and Phyllocladane diterpenoids3
Simple coumarins2
Quinoline alkaloids2
Documented compounds23 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Marmesin | present | NPASS | |
| (-)-Kaur-16-en-19-oic acid | present | LOTUS | |
| (2S,4aS,4bR,10aS)-1,1,4a-trimethyl-7-propan-2-yl-2,3,4,4b,5,6,10,10a-octahydrophenanthren-2-ol | present | LOTUS | |
| (2S,4aS,4bR,7R,10aS)-1,1,4a-trimethyl-7-propan-2-yl-3,4,4b,5,6,9,10,10a-octahydro-2H-phenanthrene-2,7-diol | present | LOTUS | |
| (4aS,4bR,7R,10aS)-7-hydroxy-1,1,4a-trimethyl-7-propan-2-yl-3,4,4b,5,6,9,10,10a-octahydrophenanthren-2-one | present | LOTUS | |
| (4aS,4bS,10aS)-1,1,4a-trimethyl-7-propan-2-yl-4,4b,5,6,10,10a-hexahydro-3H-phenanthren-2-one | present | LOTUS | |
| (8S)-8-(2-hydroxypropan-2-yl)-6-(3-methylbut-2-enoxy)-8,9-dihydrofuro[2,3-h]chromen-2-one | present | NPASS | |
| (E)-5-[(1aR,3aR,4S,5R,7aR,7bS)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpent-2-enal | present | LOTUS | |
| (E)-5-[(1S,2R,4aR,5S,8aR)-1,2,4a,5-tetramethyl-6-oxo-3,4,5,7,8,8a-hexahydro-2H-naphthalen-1-yl]-3-methylpent-2-enal | present | LOTUS | |
| (Z)-5-[(1aR,3aR,4S,5R,7aR,7bS)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpent-2-enal | present | LOTUS |
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago missouriensis has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes7
GenBank sequences9
eDNA detections4
Countries2
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Solidago missouriensis voucher CCDB-18323-D12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★trnL-F★ITS2★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Solidago missouriensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 188×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1959 +1
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.
CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.
CCDB · ipcn-api-dl — Keil, D. J. 1981. In Chromosome number reports LXXII. Taxon 30: 705–706.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. XI. Caryotypes additionnels de taxon du genre Solidago L. Naturaliste Canad. 97: 431-445.
CCDB · Cave1959 — Beaudry & Chabot 1959
CCDB · Cave1963 — Beaudry 1963
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
n 96×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Keil, D. J. 1981. In Chromosome number reports LXXII. Taxon 30: 705–706.
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.
CCDB · book-ipcn73-74 — ANDERSON, L.C., D.W. KYHOS, T. MOSQUIN, A.M. POWEL~, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. IX Haplopappus and other Astereae. Amer. J. Bot. 61: 665-671.
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 192 records
Wild obs. + sensor934
Museum / vouchered3 256
Cultivated / captive2
Origin
Native32
Introduced1
Range
Area of Occupancy AOO12 088 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 570≤1 km 84≤10 km 27>10 km 45
726 georeferenced · 208 without coordinates
Open the mapobservation + sensor934
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy37% within 1 km
≤100 m 150≤1 km 608≤10 km 1 043>10 km 240
2 041 georeferenced · 1 215 without coordinates
Open the institutions mapphysical evidence3 256
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 1 without coordinates
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions78 of 113 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 647 |
| Chicago, US | 281 |
| St. Paul, US | 240 |
| University of Alberta Museumslocation not on record | 140 |
| Missoula, US | 130 |
| Bronx, US | 128 |
| Chadron, US | 124 |
| Denver, US | 107 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 98 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 96 |
| Pullman, US | 91 |
| Spearfish, US | 77 |
| Moscow, US | 71 |
| ASUlocation not on record | 66 |
| Bozeman, US | 65 |
| Albuquerque, US | 58 |
| WTUlocation not on record | 57 |
| WINlocation not on record | 47 |
| Corvallis, US | 45 |
| Lincoln, US | 43 |
| Emporia, US | 41 |
| Madison, US | 35 |
| Flagstaff, US | 35 |
| Montréal, CA | 29 |
| Phoenix, US | 25 |
| Chongqing Museumlocation not on record | 24 |
| Pittsburg, US | 23 |
| Bloomington, US | 23 |
| Vancouver, CA | 22 |
| Saint Louis, US | 20 |
| Caldwell, US | 20 |
| Boise, US | 14 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 13 |
| Little Rock, US | 12 |
| McWane Science Centerlocation not on record | 12 |
| University of Wisconsinlocation not on record | 11 |
| Austin, US | 10 |
| Fort Worth, US | 10 |
| Provo, US | 9 |
| Riverside, US | 9 |
| VALElocation not on record | 9 |
| Davenport, US | 9 |
| Science Museum of Minnesotalocation not on record | 8 |
| Logan, US | 8 |
| Fayetteville, US | 8 |
| Québec, CA | 8 |
| Pocatello, US | 8 |
| University of Stellenboschlocation not on record | 7 |
| Bangkok, TH | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| USFS/BHSClocation not on record | 6 |
| Dekalb, US | 6 |
| Victoria, CA | 6 |
| San Luis Obispo, US | 6 |
| Tempe, US | 5 |
| IDElocation not on record | 5 |
| Waverly, US | 5 |
| CASlocation not on record | 4 |
| University of Lethbridgelocation not on record | 4 |
| US | 4 |
| Cheney, US | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Santa Barbara, US | 4 |
| Moscow State Universitylocation not on record | 4 |
| Lubbock, US | 4 |
| Mississippi State, US | 3 |
| Philadelphia, US | 3 |
| EL PASO, US | 3 |
| AUAlocation not on record | 3 |
| Ypsilanti, US | 3 |
| Mexico City, MX | 3 |
| US | 3 |
| Whitewater, US | 3 |
| Beijing, CN | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| USFSlocation not on record | 3 |
| Burlington, US | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Durango, US | 3 |
| Tacoma, US | 2 |
| US | 2 |
| GB | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Ann Arbor, US | 2 |
| Fargo, US | 2 |
| Turlock, US | 2 |
| Brookings, US | 2 |
| Grand Junction, US | 2 |
| Jackson, US | 2 |
| Weber State Universitylocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Wlocation not on record | 1 |
| Edmonton, CA | 1 |
| Chicago, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Denton, US | 1 |
| Chapel Hill, US | 1 |
| LPMMBHlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Green Bay, US | 1 |
| Russellville, US | 1 |
| Taipei, TW | 1 |
| South Kensington, GB | 1 |
| Millersville, US | 1 |
| Cslocation not on record | 1 |
| Whitehorse, CA | 1 |
| Paris, FR | 1 |
| Austin, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Chicago, US | 1 |
| Université Lavallocation not on record | 1 |
113 institutions · 3 244 of 3 256 vouchered records shown · 11 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA4 detections
Where the DNA of Solidago missouriensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map2 countries0
woods on edge of marsh with geranium, abies,…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C -0.8–16.7
Seasonal swing summer↔winter33.5 °C
Max temp (day)21.0 °C 3.30–23.6
Min temp (night)5.90 °C -4.00–11.5
Precipitation54.0 mm/mo 53.0–76.2
Air humidity55.7 % 48.6–63.2
Moisture balance-68.8 mm/mo -73.8–-15.2
Vapour deficit836 Pa 383–880
Wind speed4.00 m/s 2.90–5.30
Cloud cover40.9 % 27.4–54.2
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.