Solidago lepida

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records919

Data sources11

Biological traits7

DNA specimens26

eDNA detections13

Sources11 archives

Databases and archives Solidago lepida's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility919 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics26 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF919 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD · NCBI26 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Solidago lepida, the western Canada goldenrod or western goldenrod, is a North American plant species in the genus Solidago of the family Asteraceae. It is widespread across much of Canada, the western United States, and northern Mexico.Biota of North America Program 2014 county distribution map Description Solidago lepida is a perennial herb up to 150 cm (5 feet) tall, spreading by means of underground rhizomes. Leaves have coarse teeth and are on the stem rather than at the base. One plant can sometimes produce as many as 800 small flower heads, each with 7-22 ray florets surrounding 2-13 disc florets. VarietiesSEINet, Southwestern Biodiversity, Arizona chapter, Solidago lepida de CandolleSemple, John Cameron. 2003. : Sida 20(4): 1605-1615 Solidago lepida subsp. fallax (Fernald) Semple - Labrador, Newfoundland, Québec, New Brunswick Solidago lepida var. lepida - from Alaska east to Northwest Territories and south to California, Arizona, New Mexico, Chihuahua Solidago lepida var. salebrosa (Piper) Semple - Rocky Mountains from Alberta + British Columbia south to New Mexico, Arizona and Baja California

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding26 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago lepida has left across the world's sequence archives.

At a glance

DNA specimens26

Marker genes5

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG217534.1 ↗339 bpCanada · 2000

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago lepida voucher CCDB-18358-F8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago lepida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. XI. Caryotypes additionnels de taxon du genre Solidago L. Naturaliste Canad. 97: 431-445.

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1968. Etudes sur les Solidago. VIII. Resultats et analyse de corisements effectues entre le Solidago capadensis et Solidago lepeda var. fallax Fern. Naturaliste Canad. 95: 19-37.

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type919 records

Wild obs. + sensor721

Museum / vouchered198

Range

Area of Occupancy AOO2 624 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 444≤1 km 83≤10 km 34>10 km 18

579 georeferenced · 142 without coordinates

Open the mapobservation + sensor721

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy68% within 1 km

≤100 m 23≤1 km 24≤10 km 16>10 km 6

69 georeferenced · 129 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions33 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	24
Université Lavallocation not on record	14
Anchorage, US	14
University of Alberta Museumslocation not on record	11
Pocatello, US	10
Denver, US	10
Research Collection of B. A. Bennettlocation not on record	8
Chongqing Museumlocation not on record	8
University of Guelph, OAC Herbariumlocation not on record	6
WTUlocation not on record	6
Stockholm, SE	6
Whitehorse, CA	5
Corvallis, US	4
Caldwell, US	4
Vancouver, CA	4
Chicago, US	4
Bloomington, US	3
St. Paul, US	3
Cheney, US	3
DOI/NPS, Mount Rainier National Parklocation not on record	3
Bangkok, TH	2
Columbia, US	2
Durango, US	2
Pullman, US	2
Missoula, US	2
Uppsala, SE	2
Toronto, CA	2
Albuquerque, US	1
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Flagstaff, US	1
Logan, US	1
Phoenix, US	1
San Francisco, US	1
San Angelo, US	1
Victoria, CA	1
Orem, US	1
Riverside, US	1
Provo, US	1
University of Lethbridgelocation not on record	1
Paris, FR	1
Boise, US	1
South Kensington, GB	1
Canadian Department of Agriculturelocation not on record	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
WINlocation not on record	1
Oulu, FI	1
DOI/NPS, Colonial National Historical Parklocation not on record	1

47 institutions · 184 of 198 vouchered records shown · 14 without an institution code

09Environmental DNA13 detections

Where the DNA of Solidago lepida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Nutrient poor sedge wetland.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 9.30–17.6

Seasonal swing summer↔winter31.0 °C

Max temp (day)19.2 °C 12.3–22.3

Min temp (night)8.20 °C 4.80–14.8

Precipitation68.9 mm/mo 34.7–89.1

Air humidity56.9 % 53.8–62.4

Moisture balance-31.4 mm/mo -62.3–0.2

Vapour deficit690 Pa 449–828

Wind speed3.30 m/s 2.40–4.20

Cloud cover46.5 % 40.7–56.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)