Solidago leavenworthii

Torr. & A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records427

Data sources11

Biological traits7

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Solidago leavenworthii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility427 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionNPASS34 compounds

Occurrence & distributionGBIF427 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Solidago leavenworthii, or Leavenworth's goldenrod, is North American species of herbaceous perennial plants of the family Asteraceae. It is native to southeastern United States from Florida north to Mississippi and the Carolinas.Biota of North America Program 2014 county distribution mapUniversity of Waterloo (Canada), Astereae Lab, Solidago leavenworthii Leavenworth's GoldenrodAlabama Plant AtlasAtlas of Florida Vascular PlantsSouth Carolling Plant Atlas Solidago leavenworthii is a perennial herb up to 200 cm (80 inches or 6 2/3 feet) tall, spreading by means of underground rhizomes. Leaves are crowded together, with as many as 75 leaves on one stem, though none gathered around the base of the stem as in some related species. One plant can produce as many as 350 small yellow flower heads in a tall, branching array at the top of the plant.Flora of North America, Solidago leavenworthii Torrey & A. Gray, 1842. Leavenworth’s goldenrod

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition34 compounds

Compounds documented for Solidago leavenworthii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Pseudoguaiane sesquiterpenoids11

Guaiane sesquiterpenoids5

Germacrane sesquiterpenoids3

Eudesmane sesquiterpenoids2

Aromadendrane sesquiterpenoids2

Documented compounds34 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Cyperene	present	NPASS
(1aR,4R,4aS,7S,7aS,7bR)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-ol	present	NPASS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	NPASS
(3aR,4S,5aR,6S,9aS,9bR)-4-hydroxy-5a-methyl-3,9-dimethylidene-6-(2-methylpropoxy)-3a,4,5,6,7,8,9a,9b-octahydrobenzo[g][1]benzofuran-2-one	present	NPASS
3-(3,4,5-Trimethoxyphenyl)prop-2-enyl dec-2-en-4,6-diynoate	present	NPASS
3-(3,4,5-Trimethoxyphenyl)prop-2-enyl deca-2,6-dien-4-ynoate	present	NPASS
3-[(3E,7E,11S)-11,12-dihydroxy-4,8,12-trimethyltrideca-3,7-dienyl]-2H-furan-5-one	present	NPASS
[(3aR,4S,5aR,6R,7R,9aS,9bR)-4,7-dihydroxy-5a,9-dimethyl-3-methylidene-2-oxo-4,5,6,7,9a,9b-hexahydro-3aH-benzo[g][1]benzofuran-6-yl] (E)-2-methylbut-2-enoate	present	NPASS
[(3aR,4S,5aR,6R,7R,9aS,9bR)-4,7-dihydroxy-5a,9-dimethyl-3-methylidene-2-oxo-4,5,6,7,9a,9b-hexahydro-3aH-benzo[g][1]benzofuran-6-yl] 2-(hydroxymethyl)prop-2-enoate	present	NPASS
[(3aR,4S,5aR,6R,7R,9aS,9bR)-4,7-dihydroxy-5a,9-dimethyl-3-methylidene-2-oxo-4,5,6,7,9a,9b-hexahydro-3aH-benzo[g][1]benzofuran-6-yl] 2-methylprop-2-enoate	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago leavenworthii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKX397966.1 ↗516 bp

ACGT

TTGACTTATTATACTCCTGAATATGAAACCAAGGATACTGATATCTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAA …

Solidago leavenworthii voucher Davis 467 (FLAS) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago leavenworthii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–542n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · ipcn-api-dl · CCDB · Cave1963

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

CCDB · Cave1963 — Beaudry 1963

2n 541×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type427 records

Wild obs. + sensor186

Museum / vouchered241

Range

Area of Occupancy AOO1 260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 139≤1 km 14≤10 km 3>10 km 6

162 georeferenced · 24 without coordinates

Open the mapobservation + sensor186

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 7≤1 km 20≤10 km 24>10 km 16

67 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence241

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	60
Chapel Hill, US	27
Columbia, US	23
Bronx, US	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
Miami, US	13
Montréal, CA	13
Bangkok, TH	8
Jena Microbial Resource Collectionlocation not on record	8
Valdosta State Universitylocation not on record	8
Tall Timbers Research Stationlocation not on record	8
Chicago, US	7
Durham, US	6
Acadia Universitylocation not on record	4
Chadron, US	4
Clemson, US	3
Chongqing Museumlocation not on record	3
Knoxville, US	1
Burlington, US	1
Weber State Universitylocation not on record	1
CASlocation not on record	1
Riverside, US	1
Canadian Department of Agriculturelocation not on record	1
Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Williamsburg, US	1
Columbus State University Herbariumlocation not on record	1
Jackson, US	1
Wuzhou, CN	1
Bloomington, US	1

30 institutions · 239 of 241 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Solidago leavenworthii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.7 °C 22.7–22.7

Seasonal swing summer↔winter17.4 °C

Max temp (day)27.6 °C

Min temp (night)18.9 °C

Precipitation74.4 mm/mo

Air humidity58.9 %

Moisture balance-106 mm/mo

Vapour deficit1,128 Pa

Wind speed4.00 m/s

Cloud cover37.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)