Solidago latissimifolia

Mill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records352

Data sources11

Biological traits7

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Solidago latissimifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility352 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF352 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Solidago latissimifolia, common name Elliott's goldenrod, is North American species of flowering plants in the family Asteraceae. It is native to the Atlantic Coast of the United States and Canada, from Nova Scotia south to Alabama and Florida. Solidago latissimifolia is a perennial herb up to 400 cm tall, spreading by means of underground rhizomes. Leaves are elliptical, up to 15 cm long. One plant can produce as many as 800 small yellow flower heads, in large branching arrays at the tops of the stems. The species grows in marshes (fresh water or brackish water) and thickets on the coastal plain.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago latissimifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG220225.1 ↗443 bpCanada · 2010

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago latissimifolia voucher CCDB-18323-E12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago latissimifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidypolyploid inferred

Chromosome records18–542n range18median18mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-ipcn67-71 · CCDB · Cave1963

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. XI. Caryotypes additionnels de taxon du genre Solidago L. Naturaliste Canad. 97: 431-445.

CCDB · Cave1963 — Beaudry 1963

2n 541×CCDB · Cave1963

CCDB · Cave1963 — Beaudry 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type352 records

Wild obs. + sensor73

Museum / vouchered279

Range

Area of Occupancy AOO972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 33≤1 km 1≤10 km 2>10 km 9

45 georeferenced · 28 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 3≤1 km 30≤10 km 57>10 km 13

103 georeferenced · 176 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	83
Acadia Universitylocation not on record	40
Philadelphia, US	36
Chicago, US	21
University of Stellenboschlocation not on record	16
Chapel Hill, US	14
University of New Hampshirelocation not on record	9
Bangkok, TH	7
New Haven, US	7
Burlington, US	3
Bloomington, US	3
South Kensington, GB	2
Weymouth Woods Sandhills Nature Preservelocation not on record	2
Norfolk, US	2
Longwood Universitylocation not on record	2
Miami, US	2
Montréal, CA	2
Tampa, US	2
Columbia, US	1
Western Carolina Universitylocation not on record	1
University of Lynchburglocation not on record	1
Research Collection of B. A. Bennettlocation not on record	1
Whitehorse, CA	1
Chongqing Museumlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Saint John, CA	1
Flagstaff, US	1
University of Tennessee at Chattanoogalocation not on record	1
Maryland Department of Natural Resourceslocation not on record	1
North Carolina Museum of Natural Scienceslocation not on record	1
Podgorica, ME	1
Valdosta State Universitylocation not on record	1
Fairfax, US	1
Jena Microbial Resource Collectionlocation not on record	1

34 institutions · 269 of 279 vouchered records shown · 10 without an institution code

09Environmental DNA2 detections

Where the DNA of Solidago latissimifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 14.6–14.6

Seasonal swing summer↔winter17.0 °C

Max temp (day)16.4 °C

Min temp (night)13.2 °C

Precipitation114 mm/mo

Air humidity65.6 %

Moisture balance24.5 mm/mo

Vapour deficit571 Pa

Wind speed3.60 m/s

Cloud cover35.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)