Solidago jejunifolia

Steele · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records90

Data sources6

Biological traits6

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Solidago jejunifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility90 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF90 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago jejunifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG217442.1 ↗339 bpCanada · 1932

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago jejunifolia voucher CCDB-22991-H07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type90 records

Wild obs. + sensor31

Museum / vouchered59

Range

Area of Occupancy AOO284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 21≤1 km 2>10 km 1

24 georeferenced · 7 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 6≤1 km 19≤10 km 18>10 km 1

44 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence59

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	43
Montréal, CA	7
Madison, US	5
McWane Science Centerlocation not on record	2
WINlocation not on record	2

5 institutions · 59 of 59 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Solidago jejunifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)