Solidago houghtonii

Torr. & A.Gray ex A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records185

Data sources12

Biological traits8

DNA specimens30

eDNA detections23

Sources12 archives

Databases and archives Solidago houghtonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD · NCBI30 specimens

Genome at a glanceCCDB2n = 54

01Narrative

Solidago houghtonii is a rare North American species of flowering plant in the family Asteraceae known as Houghton's goldenrod. It is native to southern Ontario, Canada and the northern United States (Michigan and New York). It is threatened by the loss and degradation of its habitat. It is a federally listed threatened species of the United States and it is designated a species of special concern by Canada's Committee on the Status of Endangered Wildlife in Canada.Oligoneuron houghtonii. The Nature Conservancy.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago houghtonii has left across the world's sequence archives.

At a glance

DNA specimens30

Marker genes5

GenBank sequences10

eDNA detections23

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219058.1 ↗339 bpUSA · 1982

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago houghtonii voucher CCDB-22991-C09 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago houghtonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 54 n = 27

Ploidypolyploid inferred

Chromosome records54–542n range54median54mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 542×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Morton, J. K. 1979. Observations on Houghton's Goldenrod (Solidago houghtonii). Michigan Bot. 18:31–35.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type185 records

Wild obs. + sensor111

Museum / vouchered74

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 52≤1 km 4>10 km 45

101 georeferenced · 10 without coordinates

Open the mapobservation + sensor111

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 7≤1 km 19≤10 km 19

45 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence74

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Montréal, CA	39
Bronx, US	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
University of Alberta Museumslocation not on record	6
Chicago, US	5
Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record	2
Whitehorse, CA	1
Bruce Peninsula National Parklocation not on record	1
Québec, CA	1

9 institutions · 71 of 74 vouchered records shown · 3 without an institution code

09Environmental DNA23 detections

Where the DNA of Solidago houghtonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

Roadside.Several Plants scattered throughout a submes…Wetter parts of open alvar grassland dominat…Rocky shoreline.

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 16.9–16.9

Seasonal swing summer↔winter27.9 °C

Max temp (day)18.8 °C

Min temp (night)15.6 °C

Precipitation99.9 mm/mo

Air humidity60.5 %

Moisture balance-20.0 mm/mo

Vapour deficit759 Pa

Wind speed6.80 m/s

Cloud cover49.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)