Solidago glomerata

Michx. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records155

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Solidago glomerata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility155 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF155 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 108

01Narrative

Solidago glomerata, the clustered goldenrod or skunk goldenrod, is a plant species known only from the mountains of Tennessee and North Carolina. It occurs in spruce woodlands and on rocky outcrops, at elevations over 1500 m (4500 feet)Flora of North America, Solidago glomerata, vol 20 p 129.Biota of North America Program 2014 county distribution map Solidago glomerata has fleshy, rubbery leaves and yellow flower heads born in groups in the axils of the leaves and at the end of the stem.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago glomerata has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ221232.1 ↗627 bpUSA · 2009

ACGT

TCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCATGGCACACC …

Solidago glomerata voucher Phillippe & Payne 42280, TENN internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago glomerata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 108 n = 54

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1081×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Semple, J. C., J. Zhang & C. Xiang. 1993. Chromosome number determinations in fam. Compositae, tribe Astereae. V. Eastern North American taxa. Rhodora 95: 234–253.

n 541×CCDB · Cave1963

CCDB · Cave1963 — Beaudry 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type155 records

Wild obs. + sensor101

Museum / vouchered54

Range

Area of Occupancy AOO280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 59≤1 km 2≤10 km 9>10 km 11

81 georeferenced · 20 without coordinates

Open the mapobservation + sensor101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 11≤10 km 8>10 km 8

28 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence54

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	16
Chapel Hill, US	7
Bangkok, TH	6
Western Carolina Universitylocation not on record	5
Bronx, US	3
Bloomington, US	3
Beijing, CN	2
Montréal, CA	2
Appalachian State Universitylocation not on record	2
Wuzhou, CN	1
Due West, US	1
Columbia, US	1
Norfolk, US	1
Durham, US	1
Chongqing Museumlocation not on record	1

15 institutions · 52 of 54 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)