Solidago gigantea
Aiton · speciesAt a glance
Occurrence records232 333
Data sources12
Biological traits126
DNA specimens36
eDNA detections19
Sources12 archives
Databases and archives Solidago gigantea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility232 333 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources126 traits
Chemical compositionLOTUS35 compounds
Occurrence & distributionGBIF232 333 records
Environmental DNA1 datasets · 6 countries19 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT1.9 Gbp
01Narrative
Le Solidage géant ou Verge d'or géante est une espèce de plantes à fleurs du genre des Solidages et de la famille des Astéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology13
Leaf mass83.71 mg
Leaf size1 079 mm²
⚠ sources differ — TRY: 1 079 mm² · LEDA: 1 517 mm² · GIFT: 1 517 mm²
Plant height1.94 m
⚠ sources differ — GIFT: 1.94 m · LEDA: 1.38 m · USDA: 2.5 m · TRY: 0.91 m
Plant height generative1.16 m
Plant height max2.5 m
Plant height min0.5 m
Seed length2.4 mm
Seed mass0.125 mg
⚠ sources differ — TRY: 0.125 mg · LEDA: 0.062 mg · GIFT: 0.288 mg
Seed mass max0.47 mg
Seed mass min0.06 mg
Seed volume0.048 mm³
Seed volume max0.048 mm³
Seed volume min0.048 mm³
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodIndeterminate
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousYes
Flowering endSep
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formcryptophyte
⚠ sources differ — LEDA: Geophyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number899 445
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSummer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 450 m
Elevation mean1 450 m
Elevation min860 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.000000000759
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min110 days
Leaf c452 mg/g
Leaf dry-matter content (LDMC)306 mg/g
Leaf n13.9 mg/g
Leaf p2.09 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min14 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max8 pH
Soil pH min4 pH
Specific leaf area (SLA)15.94 mm²/mg
⚠ sources differ — TRY: 15.94 mm²/mg · LEDA: 20.25 mm²/mg · GIFT: 20.25 mm²/mg
Temperature min-33 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound700 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typeone-seeded generative dispersule
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Seeds per fruit>1000
03Chemical composition35 compounds
Compounds documented for Solidago gigantea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Colensane and Clerodane diterpenoids13
Simple phenolic acids5
Cinnamic acids and derivatives3
Aromadendrane sesquiterpenoids3
Germacrane sesquiterpenoids2
Documented compounds35 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-alpha-Gurjunene | present | LOTUS | |
| (-)-Ledol | present | LOTUS | |
| (4aS,7R,8R,8aS)-8-[2-(furan-3-yl)ethyl]-4,7,8-trimethyl-1,2,5,6,7,8a-hexahydronaphthalene-4a-carboxylic acid | present | LOTUS | |
| (5S,6aS,7R,8R,10aS)-5-hydroxy-7,8-dimethyl-7-[2-(5-oxo-2H-furan-3-yl)ethyl]-5,6,6a,8,9,10-hexahydro-1H-benzo[d][2]benzofuran-3-one | present | LOTUS | |
| (5S,6aS,7R,8R,10aS)-7,8-dimethyl-7-[2-(5-oxo-2H-furan-3-yl)ethyl]-5-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,6,6a,8,9,10-hexahydro-1H-benzo[d][2]benzofuran-3-one | present | LOTUS | |
| (E)-5-[(1aR,3aR,4S,5R,7aR,7bS)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpent-2-enal | present | LOTUS | |
| (E)-5-[(1S,2R,4aR,5S,8aR)-1,2,4a,5-tetramethyl-6-oxo-3,4,5,7,8,8a-hexahydro-2H-naphthalen-1-yl]-3-methylpent-2-enal | present | LOTUS | |
| (S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene | present | LOTUS | |
| (Z)-5-[(1aR,3aR,4S,5R,7aR,7bS)-4,5,7a,7b-tetramethyl-2,3,3a,5,6,7-hexahydro-1aH-naphtho[1,2-b]oxiren-4-yl]-3-methylpent-2-enal | present | LOTUS | |
| (Z)-5-[(1S,2R,4aR,5S,8aR)-1,2,4a,5-tetramethyl-6-oxo-3,4,5,7,8,8a-hexahydro-2H-naphthalen-1-yl]-3-methylpent-2-enal | present | LOTUS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago gigantea has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes9
GenBank sequences10
eDNA detections19
Countries7
The DNA barcodea real sequence read deposited for this species
ATGTTATAACAACCATGCCAGGATGGGTCGGACGTCAGTTCGATTCTCATGGCACACCGTTGATGTGCGGCCTCGATGGCCTTTTGGGTC …
Solidago gigantea isolate SOL-G-R20-4 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Solidago gigantea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 936 440 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Solidago gigantea1.94 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–542n range36median36mode27records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3615×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · fl-europaea — Beaudry, 1970
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Rudyka, E. G. 1995. Chromosome numbers in vascular plants from the southern part of the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 80(2): 87–90.
CCDB · ipcn-api-dl — Weber, E. 1997. Phenotypic variation of the introduced perennial Solidago gigantea in Europe. Nordic J. Bot. 17(6): 631–638.
CCDB · ipcn-api-dl — Zhao, Z. 1996. Documented chromosome numbers 1996:2. Miscellaneous U. S. A. and Mexican species, mostly Asteraceae. Sida 17(1): 259–263.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
CCDB · ipcn-api-dl — Skalinska, M., H. JANKUN, H. Wcislo & e. al. 1976. Further studies in chromosome numbers of Polish angiosperms. XI. Acta Biol. Cracov., Ser. Bot. 19: 107–148.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. x. Le Solidago gigantea Ait. dans l'est de l'Amerique du Nord. Naturaliste Canad. 97: 35-42.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. XI. Caryotypes additionnels de taxon du genre Solidago L. Naturaliste Canad. 97: 431-445.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-ipcn73-74 — BEAUDRY, J.R. 1974. Solidago shinnersii (Beaudry) Stat. et Comb. nov., une nouvelle espece du complexe du ~- gigantea. Naturaliste Canad. 101: 931-932.
2n 547×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-fedorov
CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.
CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
CCDB · book-ipcn73-74 — BEAUDRY, J.R. 1974. Solidago shinnersii (Beaudry) Stat. et Comb. nov., une nouvelle espece du complexe du ~- gigantea. Naturaliste Canad. 101: 931-932.
CCDB · book-fedorov — MaTBeeaa, TuxoHoaa
CCDB · book-fedorov — JI.
2n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & M. E. Lane. 1989. Chromosome number determinations in fam. Compositae, tribe Astereae. III. Additional counts and comments on generic limits and ancestral base numbers. Rhodora 91: 296–314.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. x. Le Solidago gigantea Ait. dans l'est de l'Amerique du Nord. Naturaliste Canad. 97: 35-42.
CCDB · book-ipcn73-74 — BEAUDRY, J.R. 1974. Solidago shinnersii (Beaudry) Stat. et Comb. nov., une nouvelle espece du complexe du ~- gigantea. Naturaliste Canad. 101: 931-932.
CCDB · Cave1963 — Beaudry 1963
n 91×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
n 271×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Morton, G. H. 1984. A practical treatment of the Solidago gigantea complex. Canad. J. Bot. 62: 1279–1282.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type232 333 records
Wild obs. + sensor222 381
Museum / vouchered9 297
Cultivated / captive4
Other651
Origin
Native39
Introduced2 868
Range
Area of Occupancy AOO188 784 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy60% within 1 km
≤100 m 102 145≤1 km 16 020≤10 km 79 081>10 km 708
197 954 georeferenced · 24 427 without coordinates
Open the mapobservation + sensor222 381
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 709≤1 km 1 702≤10 km 3 458>10 km 240
6 109 georeferenced · 3 188 without coordinates
Open the institutions mapphysical evidence9 297
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions153 of 257 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 275 |
| Madison, US | 537 |
| Chicago, US | 369 |
| Bronx, US | 333 |
| St. Paul, US | 324 |
| Wuzhou, CN | 276 |
| BFLlocation not on record | 238 |
| BIO-UNIPIlocation not on record | 232 |
| Uniwersytet Warszawskilocation not on record | 200 |
| Philadelphia, US | 195 |
| SLU Artdatabankenlocation not on record | 169 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 154 |
| Bloomington, US | 147 |
| Oregon State Universitylocation not on record | 146 |
| Chongqing Museumlocation not on record | 132 |
| Salzburg, AT | 128 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 104 |
| LDlocation not on record | 85 |
| DBF-NHMDlocation not on record | 82 |
| University of Alberta Museumslocation not on record | 79 |
| Ann Arbor, US | 77 |
| Moscow State Universitylocation not on record | 73 |
| MeiseBGlocation not on record | 71 |
| Provincia di Livornolocation not on record | 69 |
| Burlington, US | 68 |
| University of Wisconsinlocation not on record | 66 |
| Saint Louis, US | 66 |
| Green Bay, US | 61 |
| Pullman, US | 58 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| Denver, US | 57 |
| Fort Worth, US | 57 |
| University of New Hampshirelocation not on record | 56 |
| Acadia Universitylocation not on record | 55 |
| McWane Science Centerlocation not on record | 55 |
| Adam Mickiewicz University in Poznańlocation not on record | 52 |
| Chadron, US | 49 |
| University of Stellenboschlocation not on record | 49 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 47 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 46 |
| Montréal, CA | 44 |
| Lincoln, US | 40 |
| Austin, US | 38 |
| Görlitz, DE | 37 |
| Moscow, US | 37 |
| Pittsburg, US | 34 |
| Bangkok, TH | 34 |
| Missoula, US | 34 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 33 |
| Spearfish, US | 32 |
| Bern, CH | 30 |
| Bozeman, US | 29 |
| Québec, CA | 27 |
| Jackson, US | 25 |
| Allentown, US | 25 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 24 |
| Uniwersytet Opolskilocation not on record | 24 |
| Dekalb, US | 23 |
| Chapel Hill, US | 22 |
| Keene State Universitylocation not on record | 22 |
| New Haven, US | 21 |
| Corvallis, US | 21 |
| Oskarshamn, SE | 20 |
| Tsukuba, JP | 18 |
| Berlin, DE | 18 |
| Mount Pleasant, US | 18 |
| BRNUlocation not on record | 17 |
| College Park, US | 17 |
| Longwood Universitylocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Olocation not on record | 17 |
| GB | 17 |
| KMNlocation not on record | 17 |
| Saint John, CA | 16 |
| ZRC-SAZUlocation not on record | 16 |
| WTUlocation not on record | 16 |
| Toronto, CA | 15 |
| GJOlocation not on record | 15 |
| Chicago, US | 14 |
| Emporia, US | 14 |
| DOI/NPS, Greenbelt Parklocation not on record | 13 |
| Fayetteville, US | 13 |
| Karlsruhe, DE | 13 |
| Staten Island, US | 13 |
| Brussel, BE | 13 |
| WINlocation not on record | 12 |
| Lubbock, US | 12 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| Columbia, US | 12 |
| Vancouver, CA | 11 |
| Davenport, US | 11 |
| Museum of the Rockieslocation not on record | 10 |
| Université Lavallocation not on record | 10 |
| San Angelo, US | 9 |
| Fairfax, US | 9 |
| National Institute of Biological Resourceslocation not on record | 9 |
| Tartu, EE | 9 |
| US | 9 |
| Mlocation not on record | 9 |
| Turku, FI | 9 |
| USFS/BHSClocation not on record | 9 |
| Miami, US | 8 |
| Mississippi State, US | 8 |
| Morgantown, US | 8 |
| EL PASO, US | 8 |
| Norfolk, US | 8 |
| Flagstaff, US | 7 |
| Wlocation not on record | 7 |
| Uppsala, SE | 7 |
| Oulu, FI | 7 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 6 |
| Knoxville, US | 6 |
| Little Rock, US | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| DMZ botanic gardenlocation not on record | 6 |
| Durham, US | 6 |
| Russellville, US | 5 |
| Minia, EG | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Tacoma, US | 5 |
| Boise, US | 5 |
| Frauenfeld, CH | 5 |
| University of Tennessee at Chattanoogalocation not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Bergen, NO | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Glarus, CH | 4 |
| Clemson, US | 4 |
| Kirksville, US | 4 |
| University of Lethbridgelocation not on record | 4 |
| Pocatello, US | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| China Agricultural Universitylocation not on record | 4 |
| Durango, MX | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Chicago, US | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| Grand Junction, US | 4 |
| BDBClocation not on record | 4 |
| GAlocation not on record | 4 |
| Millersville, US | 4 |
| Williamsburg, US | 4 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Whitewater, US | 3 |
| Portland, US | 3 |
| Trondheim, NO | 3 |
| Nijmegen, NL | 3 |
| Stockholm, SE | 3 |
| Tuscaloosa, US | 3 |
| BSBIlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Macomb, US | 3 |
| Jefferson City, US | 3 |
| H-Schuhwlocation not on record | 3 |
| Namur, BE | 3 |
| Tilburg, NL | 3 |
| Stephenville, US | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| Logan, US | 3 |
| Beijing, CN | 3 |
| Nishihara, JP | 3 |
| BClocation not on record | 3 |
| Dresden, DE | 3 |
| Johnson City, US | 3 |
| SZUlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Kuopio, FI | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Fulda, DE | 2 |
| Waverly, US | 2 |
| South Kensington, GB | 2 |
| Kiritappu Wetland National Trustlocation not on record | 2 |
| Brookings, US | 2 |
| Barcelona, ES | 2 |
| MAlocation not on record | 2 |
| Phoenix, US | 2 |
| Durban, ZA | 2 |
| Hobart, AU | 2 |
| Durham, US | 2 |
| Washington, US | 2 |
| KR | 2 |
| Christchurch, NZ | 2 |
| AUAlocation not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Harrisonburg, US | 2 |
| Springfield, US | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Riverside, US | 2 |
| Provo, US | 2 |
| IDElocation not on record | 2 |
| Porrentruy, CH | 2 |
| PrivatHerblocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Umeå Universitylocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Claremont, US | 1 |
| Kochi, JP | 1 |
| Albuquerque, US | 1 |
| Madrid, ES | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| CJBGlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Columbus State Universitylocation not on record | 1 |
| Zürich, CH | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Frankfurt am Main | 1 |
| Taipei, TW | 1 |
| BAYLUlocation not on record | 1 |
| Caldwell, US | 1 |
| BGBMlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Denton, US | 1 |
| LINUlocation not on record | 1 |
| Ypsilanti, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Salamanca, ES | 1 |
| Conway, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Tempe, US | 1 |
| Paris, FR | 1 |
| NMBU:MINAlocation not on record | 1 |
| Pamplona, ES | 1 |
| Montréal, CA | 1 |
| PRClocation not on record | 1 |
| Hudson, US | 1 |
| Asheville, US | 1 |
| San Luis Obispo, US | 1 |
| Nishihara, JP | 1 |
| Decorah, US | 1 |
| Elikins, US | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Due West, US | 1 |
| Mohonk Preservelocation not on record | 1 |
| Henderson, US | 1 |
| Oswego, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Xiamen, CN | 1 |
| CASlocation not on record | 1 |
| Sion, CH | 1 |
| Whitehorse, CA | 1 |
| Kew, GB | 1 |
| Edinburgh, GB | 1 |
| Dover, US | 1 |
| Tula State Universitylocation not on record | 1 |
| Fredericksburg, US | 1 |
| Canberra, AU | 1 |
| Richmond, US | 1 |
257 institutions · 8 993 of 9 297 vouchered records shown · 247 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Solidago gigantea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map6 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 9.30–22.0
Seasonal swing summer↔winter19.9 °C
Max temp (day)19.5 °C 13.1–25.0
Min temp (night)12.2 °C 5.00–19.7
Precipitation81.1 mm/mo 63.4–95.7
Air humidity61.1 % 58.0–63.4
Moisture balance-25.9 mm/mo -52.5–15.8
Vapour deficit717 Pa 458–1,071
Wind speed3.70 m/s 2.90–5.00
Cloud cover41.2 % 37.6–52.8
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.