Solidago brendae

Semple · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records163

Data sources6

Biological traits3

DNA specimens10

eDNA detections5

Sources6 archives

Databases and archives Solidago brendae's data was compiled from.

GBIFGlobal Biodiversity Information Facility163 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF163 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

02Traits & measurements

SourcesGIFT

Habitat & environment3

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago brendae has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219717.1 ↗338 bpCanada · 1983

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago brendae voucher CCDB-24918-E02 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★rbcLa★ITS5★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type163 records

Museum / vouchered163

Range

Area of Occupancy AOO528 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy69% within 1 km

≤100 m 9≤1 km 27≤10 km 15>10 km 1

52 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence163

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	77
Montréal, CA	76
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	4
Whitehorse, CA	1
Burlington, US	1

5 institutions · 159 of 163 vouchered records shown · 4 without an institution code

09Environmental DNA5 detections

Where the DNA of Solidago brendae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

weedy slope and field beside riverTerrain graveleux attenant a une carriere de…among rocks in river bedroadsideMuskeg, wooded

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.1 °C 15.9–17.2

Seasonal swing summer↔winter32.3 °C

Max temp (day)21.5 °C 19.7–22.4

Min temp (night)12.9 °C 12.0–14.4

Precipitation102 mm/mo 83.1–120

Air humidity60.0 % 58.9–60.9

Moisture balance-20.3 mm/mo -27.1–5.90

Vapour deficit745 Pa 708–800

Wind speed3.20 m/s 2.50–3.60

Cloud cover47.4 % 43.0–50.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)