Solidago arguta

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Solidago

At a glance

Occurrence records548

Data sources11

Biological traits15

DNA specimens7

eDNA detections3

Sources11 archives

Databases and archives Solidago arguta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionNPASS2 compounds

Occurrence & distributionGBIF548 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Solidago arguta là một loài thực vật có hoa trong họ Cúc. Loài này được Aiton miêu tả khoa học đầu tiên năm 1789.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.6 m

Plant height min0.4 m

Seed mass2.05 mg

Life cycle & reproduction4

Flowering endSep

Flowering startJul

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTintroduced

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Solidago arguta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Chalcones1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Derricidin		present	NPASS
VQBWFYNSXWMURP-FQEVSTJZSA-N		present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago arguta has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG217520.1 ↗339 bpCanada · 1934

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Solidago arguta voucher 15489HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Solidago arguta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode14records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1812×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +4

CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.

CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.

CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].

CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.

CCDB · book-ipcn66 — Kapoor& Beaudry 1966

CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.

CCDB · eflora

CCDB · book-fedorov — Beaudry 1963

CCDB · Cave1959 — Beaudry & Chabot 1959

CCDB · Cave1963 — Beaudry 1963

2n 362×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · eflora

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Esselman, E. J. & D. J. Crawford. 1997. Molecular and morphological evidence for the origin of Solidago albopilosa (Asteraceae), a rare endemic of Kentucky. Syst. Bot. 22(2): 245–257.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type548 records

Wild obs. + sensor239

Museum / vouchered309

Range

Area of Occupancy AOO1 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 160≤1 km 14≤10 km 7>10 km 20

201 georeferenced · 38 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 1≤1 km 14≤10 km 95>10 km 50

160 georeferenced · 149 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	70
University of New Hampshirelocation not on record	49
New Haven, US	28
Miami, US	17
Saint Louis, US	15
Keene State Universitylocation not on record	14
Wuzhou, CN	9
Chicago, US	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Toronto, CA	3
University of Stellenboschlocation not on record	3
Durham, US	3
Jena Microbial Resource Collectionlocation not on record	3
University of Guelph, OAC Herbariumlocation not on record	2
Millersville, US	2
University of Alberta Museumslocation not on record	2
Chicago, US	2
Paris, FR	1
Ann Arbor, US	1
Emporia, US	1
Barcelona, ES	1
Kew, GB	1
Northridge, US	1
LINUlocation not on record	1
Vancouver, CA	1
LDlocation not on record	1
Austin, US	1
Cambridge, US	1

29 institutions · 248 of 309 vouchered records shown · 61 without an institution code

09Environmental DNA3 detections

Where the DNA of Solidago arguta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.40 °C 2.10–2.70

Seasonal swing summer↔winter26.4 °C

Max temp (day)6.30 °C 6.00–6.60

Min temp (night)-0.4 °C -0.6–-0.2

Precipitation88.2 mm/mo 84.8–91.6

Air humidity63.3 % 62.7–63.9

Moisture balance53.8 mm/mo 49.9–57.6

Vapour deficit269 Pa 259–278

Wind speed4.80 m/s 4.70–4.90

Cloud cover62.9 % 62.7–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)