Solidago altissima
speciesAt a glance
Occurrence records12 032
Data sources11
Biological traits95
DNA specimens17
eDNA detections20
Sources11 archives
Databases and archives Solidago altissima's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 032 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources95 traits
Chemical compositionLOTUS83 compounds
Occurrence & distributionGBIF12 032 records
Environmental DNA1 datasets · 2 countries20 detections
DNA & barcodingBOLD · NCBI17 specimens
Genome at a glanceCCDB2n = 54
01Narrative
Solidago altissima, en anglais tall goldenrod, est une espèce de plante à fleurs de la famille des Asteraceae, d'origine nord-américaine répandue dans une grande partie du Canada, des États-Unis et du nord du Mexique. Elle est commune dans une grande partie de son aire de répartition et assez tolérante à l'anthropisation des paysages. Elle s'est naturalisée dans de nombreuses régions du monde. Solidago altissima mesure un à deux mètres de haut, avec des poils fins sur la tige. Les feuilles sont situées le long de la tige. Une plante peut produire jusqu'à 1500 petites têtes de fleurs jaunes dans un large éventail conique. Solidago altissima est auto-incompatible. Le pollen d'une plante ne peut pas polliniser les parties florales femelles de la même plante.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRYUSDA
Size & morphology5
Plant height1.52 m
Plant height max2 m
Seed mass0.093 mg
Seed mass max0.11 mg
Seed mass min0.06 mg
Life cycle & reproduction25
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Dispersal typewind
Flower colouryellow
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment25
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorYellow-Green
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
Growth form USDARhizomatous
Habitat GIFTopen roadsides open open, roadside
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry18
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min130 days
Moisture useMedium
Nitrogen fixation levelNone
Precipitation max55 in
Precipitation min18 in
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7.3 pH
Soil pH min5.2 pH
Temperature min-28 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound700 000 per lb
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max2 700 per acre
Planting density min1 700 per acre
03Chemical composition83 compounds
Compounds documented for Solidago altissima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Colensane and Clerodane diterpenoids37
Flavonols12
Cinnamic acids and derivatives11
Wax diesters $ Wax monoesters5
Unsaturated fatty acids3
Documented compounds83 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2Z,8Z)-Matricaria Acid Methyl Ester | present | LOTUS | |
| (3beta,13alpha,14beta)-13-Methyl-26-norurs-7-en-3-ol | present | LOTUS | |
| (4aS,5R,6S,8aS)-5-[(E)-4-carboxy-3-methylbut-3-enyl]-5,6,8a-trimethyl-3,4,4a,6,7,8-hexahydronaphthalene-1-carboxylic acid | present | LOTUS | |
| (5E)-5-[(4E)-Hex-4-en-2-yn-1-ylidene]furan-2(5H)-one | present | LOTUS | |
| (5E)-5-[(Z)-oct-6-en-2,4-diynylidene]furan-2-one | present | LOTUS | |
| (E)-5-[(1R,2S,3R,4aR,8aR)-3-acetyloxy-1,2,4a,5-tetramethyl-2,3,4,7,8,8a-hexahydronaphthalen-1-yl]-3-methylpent-2-enoic acid | present | LOTUS | |
| (E)-5-[(1R,2S,3S,4aR,8aR)-3-acetyloxy-1,2,4a,5-tetramethyl-2,3,4,7,8,8a-hexahydronaphthalen-1-yl]-3-methylpent-2-enoic acid | present | LOTUS | |
| (E)-5-[(1S,2R,4R,4aR,8aR)-1,2,4a,5-tetramethyl-4-[(E)-2-methylbut-2-enoyl]oxy-2,3,4,7,8,8a-hexahydronaphthalen-1-yl]-3-methylpent-2-enoic acid | present | LOTUS | |
| (S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene | present | LOTUS | |
| 2(5H)-Furanone,4-hexadiynylidene)- | present | LOTUS |
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solidago altissima has left across the world's sequence archives.
At a glance
DNA specimens17
Marker genes5
GenBank sequences10
eDNA detections20
Countries2
The DNA barcodea real sequence read deposited for this species
TTTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTATT …
Solidago altissima chloroplast, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL10★rbcLa★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Solidago altissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 54 n = 27
Ploidypolyploid inferred
Chromosome records18–542n range45median54mode28records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5414×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · slov-fl — Uhríková A. & Králik E., 2000: Karyologické štúdium slovenskej flóry XXIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 17-22.
CCDB · ipcn-api-dl — Melville, M. R. & J. K. Morton. 1982. A biosystematic study of the Solidago canadensis (Compositae) complex. I. The Ontario populations. Canad. J. Bot. 60(6): 976–997.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. IOPB chromosome number reports LXXVII. Taxon 31: 766–768.
CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.
CCDB · ipcn-api-dl — Semple, J. C., G. S. Ringius, C. Leeder & G. Morton. 1984. Chromosome numbers of goldenrods, Euthamia and Solidago (Compositae: Astereae). II. Additional counts with comments on cytogeography. Brittonia 36(3): 280–292 [erratum 37: 121].
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · book-ipcn66 — Kapoor& Beaudry 1966
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.
CCDB · eflora
CCDB · Cave1957 — Beaudry & Chabot
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982d). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 766-768.
CCDB · CromoCat 2015 — Peng, C. -I. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVIII]. Taxon 26(5/6): 562-564.
2n 369×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Turner, B. L. & Z. Zhao. 1992. Documented chromosome numbers 1992: 2. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 147–150.
CCDB · ipcn-api-dl — Zhao, Z. 1996. Documented chromosome numbers 1996:2. Miscellaneous U. S. A. and Mexican species, mostly Asteraceae. Sida 17(1): 259–263.
CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.
CCDB · ipcn-api-dl — Semple, J. C. & J. G. Chmielewski. 1987. Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
CCDB · ipcn-api-dl — Semple, J. C., J. G. Chmielewski & C. Xiang. 1992. Chromosome number determinations in fam. Compositae, tribe Astereae. IV. Additional reports and comments on the cytogeography and status of some species of Aster and Solidago. Rhodora 94: 48–62.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1969. Etudes sur les Solidago L. IX. Une liste de nombres chromosomiques des taxons du genre Solidago et de certains genres voisins. Naturaliste Canad. 96: 103-114.
CCDB · CromoCat 2015 — Zhao, Z. (1996). Documented chromosome numbers 1996:2. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae Sida 17:(1): 259-263
CCDB · CromoCat 2015 — Semple, J. C. & J. G. Chmielewski. (1987). Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
2n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Semple, J. C. 1985. Chromosome number determinations in fam. Compositae tribe Astereae. Rhodora 87: 517–527.
CCDB · ipcn-api-dl — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. 2001. Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
CCDB · book-ipcn67-71 — BEAUDRY, J.R. 1970. Etudes sur les Solidago. XI. Caryotypes additionnels de taxon du genre Solidago L. Naturaliste Canad. 97: 431-445.
CCDB · CromoCat 2015 — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. (2001). Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Semple, J. C. & J. G. Chmielewski. (1987). Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Semple, J. C., C. Xiang, J. Zhang, M. Horsburgh & R. Cook. (2001). Chromosme number determinations in Fam. Compositae, tribe Astereae. VI. Western North American taxa and comments on generic treatments of North American asters. Rhodora 103: 202–218.
CCDB · CromoCat 2015 — Semple, J. C. & J. G. Chmielewski. (1987). Chromosome number determinations in fam. Compositae, tribe Astereae. II. Additional counts. Rhodora 89: 319–325.
n 272×CCDB · Cave1957 · CCDB · Cave1959
CCDB · Cave1957 — Beaudry & Chabot
CCDB · Cave1959 — Beaudry & Chabot 1959
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type12 032 records
Wild obs. + sensor8 501
Museum / vouchered3 531
Origin
Native12
Introduced39
Range
Area of Occupancy AOO31 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 5 372≤1 km 595≤10 km 228>10 km 401
6 596 georeferenced · 1 905 without coordinates
Open the mapobservation + sensor8 501
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 282≤1 km 451≤10 km 609>10 km 101
1 443 georeferenced · 2 088 without coordinates
Open the institutions mapphysical evidence3 531
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions138 of 214 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chiba, JP | 262 |
| Philadelphia, US | 256 |
| Chicago, US | 178 |
| Odawara, JP | 154 |
| Ann Arbor, US | 117 |
| Oregon State Universitylocation not on record | 115 |
| Tokushima, JP | 104 |
| St. Paul, US | 84 |
| Millersville, US | 82 |
| Chongqing Museumlocation not on record | 80 |
| Bangkok, TH | 71 |
| Bando, JP | 69 |
| Kochi, JP | 68 |
| Nagano City, JP | 63 |
| Fort Worth, US | 57 |
| Durango, MX | 53 |
| Tsukuba, JP | 51 |
| Madison, US | 49 |
| Sanda, JP | 45 |
| Williamsburg, US | 44 |
| Jena Microbial Resource Collectionlocation not on record | 44 |
| New Haven, US | 43 |
| Fukushima Universitylocation not on record | 41 |
| University of Wisconsinlocation not on record | 38 |
| Austin, US | 37 |
| Université Lavallocation not on record | 37 |
| McWane Science Centerlocation not on record | 37 |
| Québec, CA | 36 |
| Emporia, US | 35 |
| Jackson, US | 34 |
| College Park, US | 29 |
| Green Bay, US | 28 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 27 |
| Columbia, US | 27 |
| Phoenix, US | 27 |
| Chapel Hill, US | 24 |
| Dekalb, US | 24 |
| Tomioka, JP | 21 |
| US | 21 |
| Saint Louis, US | 20 |
| University of New Hampshirelocation not on record | 19 |
| Davenport, US | 18 |
| Shinshu Universitylocation not on record | 18 |
| Sagamihara, JP | 18 |
| Morgantown, US | 17 |
| Ishikawa Museum of Natural Historylocation not on record | 17 |
| Burlington, US | 16 |
| Tuscaloosa, US | 16 |
| Hiratsuka City Museumlocation not on record | 16 |
| KURAlocation not on record | 16 |
| Flagstaff, US | 15 |
| Staten Island, US | 14 |
| Norfolk, US | 14 |
| University of Stellenboschlocation not on record | 13 |
| University of Alberta Museumslocation not on record | 13 |
| Toronto, CA | 13 |
| Mexico City, MX | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Bronx, US | 13 |
| Toyama, JP | 12 |
| Osaka, JP | 12 |
| Pittsburg, US | 11 |
| BAYLUlocation not on record | 11 |
| Chicago, US | 11 |
| EL PASO, US | 11 |
| Mie Prefectural Museumlocation not on record | 10 |
| Saint John, CA | 10 |
| Macomb, US | 10 |
| Otaru, JP | 10 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 10 |
| Chadron, US | 10 |
| Riverside, US | 10 |
| ASUlocation not on record | 9 |
| Little Rock, US | 8 |
| AUAlocation not on record | 8 |
| University of Tennessee at Chattanoogalocation not on record | 8 |
| Nishihara, JP | 7 |
| Sendai, JP | 7 |
| University of Southern Mississippilocation not on record | 7 |
| Texas Lutheran Universitylocation not on record | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Richmond, US | 6 |
| Santa Barbara, US | 6 |
| JP | 6 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 6 |
| Allentown, US | 6 |
| Keene State Universitylocation not on record | 6 |
| Denver, US | 6 |
| Tampa, US | 6 |
| Wlocation not on record | 5 |
| Johnson City, US | 5 |
| Toyota city nature sanctuarylocation not on record | 5 |
| Montréal, CA | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Bloomington, US | 5 |
| GB | 5 |
| Museum of the Rockieslocation not on record | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Barcelona, ES | 5 |
| Hudson, US | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| Spearfish, US | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Beijing, CN | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Minia, EG | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| Moscow, US | 4 |
| New Brunswick, US | 4 |
| Taipei, TW | 4 |
| Moscow State Universitylocation not on record | 4 |
| Kagoshima, JP | 4 |
| Whitehorse, CA | 4 |
| San Angelo, US | 4 |
| Fredericksburg, US | 4 |
| SIHUlocation not on record | 3 |
| Asheville, US | 3 |
| Pullman, US | 3 |
| Fairfax, US | 3 |
| Tempe, US | 3 |
| San Luis Obispo, US | 3 |
| Lubbock, US | 3 |
| Vancouver, CA | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| Knoxville, US | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| Oswego, US | 3 |
| Davis, US | 3 |
| Waverly, US | 3 |
| Durban, ZA | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Taipei, TW | 2 |
| Whitewater, US | 2 |
| Clemson, US | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Philadelphia, US | 2 |
| WINlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Columbus State Universitylocation not on record | 2 |
| xMDC-Clintonlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Albuquerque, US | 2 |
| Claremont, US | 2 |
| Jefferson City, US | 2 |
| Washington, US | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Paris, FR | 2 |
| Taipei, TW | 2 |
| Ypsilanti, US | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Mexico City, MX | 2 |
| MAlocation not on record | 2 |
| GAlocation not on record | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Mount Berry, US | 2 |
| Austin, US | 2 |
| Mohonk Preservelocation not on record | 1 |
| Canberra, AU | 1 |
| Long Beach, US | 1 |
| Sapporo, JP | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Jaén, ES | 1 |
| MeiseBGlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Armidale, AU | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Missoula, US | 1 |
| Cambridge, US | 1 |
| Grand Junction, US | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| South Kensington, GB | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Linares, MX | 1 |
| Hazara Universitylocation not on record | 1 |
| San Diego, US | 1 |
| Smithfield, AU | 1 |
| Durham, US | 1 |
| Nishihara, JP | 1 |
| Lincoln, US | 1 |
| Cambridge, US | 1 |
| Pocatello, US | 1 |
| Kingston, US | 1 |
| Boise, US | 1 |
| Due West, US | 1 |
| KIRMlocation not on record | 1 |
| Logan, US | 1 |
| Turlock, US | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Mount Pleasant, US | 1 |
| Chicago, US | 1 |
| Hamilton, US | 1 |
| DNSMlocation not on record | 1 |
| Chapingo, MX | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Kensington, AU | 1 |
| Hobart, AU | 1 |
| Wuzhou, CN | 1 |
| Mount Annan, AU | 1 |
| Denton, US | 1 |
214 institutions · 3 468 of 3 531 vouchered records shown · 63 without an institution code
09Environmental DNA20 detections
Where the DNA of Solidago altissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 11.6–20.2
Seasonal swing summer↔winter26.2 °C
Max temp (day)20.8 °C 14.2–24.7
Min temp (night)14.2 °C 7.20–16.9
Precipitation94.1 mm/mo 74.8–99.4
Air humidity59.5 % 55.9–60.6
Moisture balance-10.7 mm/mo -32.3–19.3
Vapour deficit757 Pa 552–971
Wind speed3.40 m/s 2.40–4.70
Cloud cover49.1 % 34.9–55.0
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.