Solen strictus

Gould, 1861 · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Adapedonta/Solenidae/Solen

At a glance

Occurrence records982

Data sources7

Biological traits2

DNA specimens47

eDNA detections35

Sources7 archives

Databases and archives Solen strictus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility517 records↗

OBISOcean Biodiversity Information System465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics47 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS982 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD47 specimens

01Narrative

Gould's razor shell (Solen strictus) is a bivalve mollusc of the family Solenidae. It is common in Japan in sandy coastal zones of the western, southern and northeastern coasts, and also in South Korea, China and Taiwan. It lives on the sandy littoral zone, preferring the depth of about 20–50 cm.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding47 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solen strictus has left across the world's sequence archives.

At a glance

DNA specimens47

BINs3

Marker genes13

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 139 variable positions, in barcode order

3Amostly conserved

9Amostly conserved

30Amostly conserved

36Cmostly conserved

37Tmostly conserved

39Amostly conserved

45Tmostly conserved

48Tmostly conserved

51Gmostly conserved

52Cmostly conserved

54Amostly conserved

69Tvariable

72Gmostly conserved

75Gmostly conserved

78Amostly conserved

84Gmostly conserved

87Amostly conserved

90Avariable

93Avariable

96Tmostly conserved

102Avariable

105Tmostly conserved

111Tmostly conserved

126Tmostly conserved

129Gvariable

135Tmostly conserved

138Tmostly conserved

144Cvariable

165Avariable

168Amostly conserved

171Tmostly conserved

174Amostly conserved

183Gvariable

186Tmostly conserved

192Gmostly conserved

195Cvariable

199Cmostly conserved

201Gvariable

204Tmostly conserved

207Tmostly conserved

208Tmostly conserved

210Gmostly conserved

219Tmostly conserved

225Amostly conserved

228Tmostly conserved

237Cvariable

240Avariable

243Amostly conserved

246Amostly conserved

249Tmostly conserved

252Tmostly conserved

258Tmostly conserved

264Gmostly conserved

265Tmostly conserved

270Gmostly conserved

273Amostly conserved

276Tmostly conserved

283Tmostly conserved

289Tmostly conserved

292Tvariable

300Tmostly conserved

303Gmostly conserved

304Tmostly conserved

309Tmostly conserved

312Tmostly conserved

315Tmostly conserved

321Tmostly conserved

333Amostly conserved

339Tmostly conserved

342Tmostly conserved

345Tmostly conserved

348Tmostly conserved

351Cvariable

354Tmostly conserved

357Amostly conserved

363Gmostly conserved

366Cvariable

369Cvariable

372Tmostly conserved

378Gmostly conserved

384Gmostly conserved

387Tmostly conserved

393Tmostly conserved

405Gmostly conserved

414Tmostly conserved

417Tmostly conserved

423Tmostly conserved

426Tvariable

430Tmostly conserved

432Gvariable

435Avariable

438Avariable

450Gvariable

453Tmostly conserved

456Amostly conserved

465Cmostly conserved

471Tmostly conserved

474Tmostly conserved

477Tvariable

489Avariable

492Gmostly conserved

495Tmostly conserved

501Gmostly conserved

502Tmostly conserved

504Gmostly conserved

510Gmostly conserved

519Gmostly conserved

522Gvariable

525Tmostly conserved

528Amostly conserved

531Tmostly conserved

534Tvariable

537Gvariable

538Tmostly conserved

540Gvariable

541Amostly conserved

549Cmostly conserved

555Amostly conserved

558Gmostly conserved

559Tmostly conserved

+19 more variable positions not shown

GGAACTTTATATATTATTTTTGCTGTTTGATCTGGCTTAGTTGGTACTAGGCTAAGAATTTTAATTCGTTTGGAGTTAGCTCGGCCAGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.0%

Haplotypes7

BINs3

Most divergent pair17.9%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Solen grandissame genus14.9%Solen marginatussame genus16.5%Solen sicariussame genus16.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS118S-3PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_017616 ↗ · 12 protein · 22 tRNA · 2 rRNA

COX1COX2ND3ND1ND6ND5CYTBATP6COX3ND4LND4ND2l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type982 records

Wild obs. + sensor171

Museum / vouchered796

Fossil15

Range

Area of Occupancy AOO536 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 50 m · max 50 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 10≤1 km 5≤10 km 4>10 km 2

21 georeferenced · 150 without coordinates

Open the mapobservation + sensor171

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 2≤1 km 1≤10 km 5>10 km 4

12 georeferenced · 784 without coordinates

Open the institutions mapphysical evidence796

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	257
Toyama, JP	73
Paris, FR	23
Sydney, AU	14
Bando, JP	14
Santa Barbara Museum of Natural Historylocation not on record	13
NSMKlocation not on record	10
Washington, US	9
Philadelphia, US	8
Sam Noble Oklahoma Museum of Natural Historylocation not on record	6
Natural History Museum Rotterdamlocation not on record	4
Gifu prefectural Museumlocation not on record	3
Cambridge, US	2
Gyeryonsan Natural History Museumlocation not on record	2
Wakayama Prefectural Museum of Natural Historylocation not on record	2
Nishinomiya Shell Museumlocation not on record	2
Mutare Museumlocation not on record	1
Denver, US	1
CASlocation not on record	1
Tomioka, JP	1
Los Angeles, US	1
Chongqing Museumlocation not on record	1

22 institutions · 448 of 796 vouchered records shown · 3 without an institution code

09Environmental DNA35 detections

Where the DNA of Solen strictus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.50–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C 12.0–15.7

Min temp (night)3.10 °C

Precipitation13.8 mm/mo 13.8–212

Air humidity45.7 % 45.7–57.2

Moisture balance-95.2 mm/mo -95.2–120

Vapour deficit827 Pa 588–827

Wind speed4.50 m/s 3.50–4.50

Cloud cover24.1 % 24.1–36.4

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)