Solanum violaceum
Ortega · speciesAt a glance
Occurrence records924
Data sources14
Biological traits20
DNA specimens12
eDNA detections12
Sources14 archives
Databases and archives Solanum violaceum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility924 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics12 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources20 traits
Chemical compositionLOTUS · NPASS55 compounds
Occurrence & distributionGBIF924 records
Environmental DNA1 datasets · 3 countries12 detections
DNA & barcodingBOLD · NCBI12 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24
01Narrative
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Plant height1 m
⚠ sources differ — GIFT: 1 m · TRY: 1.5 m
Plant height max2 m
Seed mass2.88 mg
⚠ sources differ — TRY: 2.88 mg · GIFT: 2.58 mg
Seed mass max3 mg
Seed mass min2.17 mg
Life cycle & reproduction3
Life formshrub
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 300 m
Elevation min600 m
Epiphyteterrestrial
Growth formshrub
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Plant support typefree-standing
03Chemical composition55 compounds
Compounds documented for Solanum violaceum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Spirostane steroids24
Steroidal alkaloids10
Stigmastane steroids9
Cinnamic acid amides7
Cholestane steroids $ Ergostane steroids4
Documented compounds55 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Syringaresinol | present | LOTUS | |
| (25S)-3beta-spirostan-5-ene-3-ol-3-O-alpha-L-rhamnopyranosyl-(1->2)-[alpha-L-rhamnopyranosyl-(1->4)]-beta-D-glucopyranoside | present | LOTUS | |
| (2R,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[[(3S,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-7-hydroxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-2-[(1S,2S,3'S,4S,5'R,6R,6'R,7S,8R,9S,12S,13R,16S)-3',6'-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,16S)-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-16-yl]oxy]-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-2-[(1S,2S,3'S,4S,5'R,6R,6'R,7S,8R,9S,12S,13R,16S)-3',6'-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4-hydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'S,6S,7R,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-[(2S,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'S,6S,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS |
05DNA & barcoding12 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum violaceum has left across the world's sequence archives.
At a glance
DNA specimens12
Marker genes4
GenBank sequences10
eDNA detections12
Countries3
The DNA barcodea real sequence read deposited for this species
TAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGG …
Solanum violaceum isolate vio4 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL8★ITS★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Solanum violaceum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2420×GoaT · Tree of Sex Database · CCDB · ita-fl · CCDB · iber-fl +7
GoaT · Tree of Sex Database — ↗
CCDB · ita-fl — BINI MALECI L., MORI B. - 1972. Numeri cromosomici per la flora italiana:131-134.. Inform. Bot. Ital. , 4(3): 224-226.
CCDB · iber-fl — IOPB. Chromosome data 7 (ed. A. Stace). Diosdado, J. C. & al.Intern. Organ. Plant Biosyst.22: 3-4(1994).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 373-381. Fernndez, I., M. J. Dez & J. Pastor.Lagascalia13(2): 299-302(1985).
CCDB · ipcn-api-dl — Govindarajan, T. & N. Vijayakumar. 1986. Cytotaxonomical studies of south Indian Solanum and Lycopersicum. J. Indian Bot. Soc. 66: 373–376.
CCDB · ipcn-api-dl — Raju, D. S. S., K. V. Moorty, P. B. Kirti & B. G. S. RAO. 1981. Studies on the origin of Solanum melongena L. (egg plant): I. Cytogenetics of interspecific hybrids between S. indicum L. and S. surattense Burm. f. (= S. xanthocarpum Schrad and Wendl). Indian J. Bot. 4: 91–98.
CCDB · ipcn-api-dl — Wu, S. & Z. Li. 1985. Preliminary studies of chromosome morphology of several wild and cultivated eggplants. Acta Bot. Sin. 27: 361–369.
CCDB · ipcn-api-dl — Rao, Y. V. & B. G. S. RAO. 1987. Cytomorphological studies of the hybrids between Solanum pubescens, Solanum incanum and Solanum indicum. Proc. Indian Acad. Sci., Pl. Sci. 97: 49–53.
CCDB · ipcn-api-dl — Fernández, I., M. J. Díez & J. Pastor. 1985. Números 373-381, in Números cromosómicos para la flora española. 363-434. Lagascalia 13: 299–302.
CCDB · ipcn-api-dl — Diosdado, J. C., J. Vioque, R. Juan & J. Pastor. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3–4.
CCDB · ipcn-api-dl — Karihaloo, J. L. 1991. Desynapsis due to temperature stress in three species of Solanum L. Cytologia 56: 603–611.
CCDB · book-ipcn72 — MALECI, L.B., & B. MORI. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital.4: 224-236.
CCDB · book-ipcn67-71 — GERASIMENKO, I.I., & S.A. REZNIKOVA. 1968. A cytological investigation of the genus Solanum L. (In Russian) Bot. Zurn. 53: 505-513.
CCDB · book-indian_vol1 — Bhaduri, P.N. 1933, 1935 ; Miege, G. 1962; Rao, B.G.S. 1962 ; Bezbaruah, H.P. & Bezbaruah, B. 1963 ; Baquar, S.R. 1967a; Zutshi, U. 1967; Baquar, S.R. 1967-1968 ; 'Gerasimenko, I.I. & Reznikova, S.A. 1968 ; Rajasekaran, S. 1970 ; Gill, L.S. 1972 ; Krishnappa, D.G. & Chennaveeraiah, M.S. 1975 ; Rao, N.N. et al. 1980
CCDB · book-indian_vol1 — Zutshi, U. 1967 ; Madhavadian, P. 1968; Kirti, P.B. & Rao, B.G.S. 1978a
CCDB · book-atlas-flowering-plants — Bhaduri 1935
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — Goldblatt1979 ↗
n 1219×CCDB · iapt · CCDB · iber-fl · CCDB · solan +6
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 664-690. Ruz de Clavijo Jimnez, E.Lagascalia17(1): 161-172(1993).
CCDB · solan
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Bir, S. S. & Neelam. 1984. SOCGI plant chromosome number reports -- II. J. Cytol. Genet. 19: 113–114.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1993. Números cromosomáticos para la flora Española 664--690. Lagascalia 17: 161–172.
CCDB · ipcn-api-dl — Karihaloo, J. L. 1991. Desynapsis due to temperature stress in three species of Solanum L. Cytologia 56: 603–611.
CCDB · book-ipcn72 — GILL, L.S. 1972. Chromosome numbers in West-Himalayan bicarpellate species II. Bull. Torrey Bot. Club 99: 36-38.
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · book-ipcn75-78 — Kirti & Rao 1978
CCDB · book-ipcn75-78 — Randell & Riyanti in Randell & Symon 1976
CCDB · Cave1956supp — Gottschalk 1954a
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — carr1985 ↗
TreeOfSex · plant — Goldblatt1979|randell1976 ↗
TreeOfSex · plant — Goldblatt1979|medsbangladesh ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type924 records
Wild obs. + sensor384
Museum / vouchered309
Cultivated / captive2
Other229
Origin
Native45
Introduced2
Range
Area of Occupancy AOO2 484 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 138≤1 km 68≤10 km 28>10 km 12
246 georeferenced · 138 without coordinates
Open the mapobservation + sensor384
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 4≤1 km 36≤10 km 16>10 km 6
62 georeferenced · 247 without coordinates
Open the institutions mapphysical evidence309
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 2
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions17 of 27 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| South Kensington, GB | 59 |
| Yangling, CN | 27 |
| Baroda, IN | 27 |
| Museo Entomologico de Leonlocation not on record | 18 |
| Kew, GB | 18 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 16 |
| Kunming, CN | 15 |
| Taipei, TW | 13 |
| Bronx, US | 11 |
| TAIElocation not on record | 9 |
| Beijing, CN | 8 |
| 云南省思茅市民族传统医药研究所location not on record | 8 |
| Taipei, TW | 7 |
| Edinburgh, GB | 4 |
| Paris, FR | 4 |
| Saint Louis, US | 3 |
| Guilin, CN | 3 |
| University of Stellenboschlocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Moscow State Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| National Pingtung University of Science and Technologylocation not on record | 1 |
| Honolulu, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Uppsala, SE | 1 |
| Plocation not on record | 1 |
| Brisbane, AU | 1 |
27 institutions · 262 of 309 vouchered records shown · 45 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA12 detections
Where the DNA of Solanum violaceum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found12
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 12 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.0 °C 13.4–26.4
Seasonal swing summer↔winter12.8 °C
Max temp (day)26.7 °C 18.1–30.3
Min temp (night)17.6 °C 6.90–23.3
Precipitation86.3 mm/mo 5.50–227
Air humidity55.2 % 45.4–66.7
Moisture balance-37.0 mm/mo -110–86.2
Vapour deficit1,083 Pa 821–1,455
Wind speed3.50 m/s 2.60–4.30
Cloud cover23.6 % 17.1–26.2
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.