Solanum vaillantii

Dunal · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records254

Data sources11

Biological traits11

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Solanum vaillantii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Solanum vaillantii là loài thực vật có hoa trong họ Cà. Loài này được Dunal miêu tả khoa học đầu tiên năm 1814.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTFloresta Estacional Decidual, Floresta Ombrófila Mista

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum vaillantii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ457402.1 ↗635 bpBrazil

ACGT

GGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACACGTTCAAACACTGGGGGGGCCGTGCGGCGGGGGCGCTTCGGCGCCGCC …

Solanum vaillantii isolate LB2866 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum vaillantii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Chiarini. 2006. Karyotype studies in South American species of Solanum subgen. Leptostemonum (Solanaceae). Pl. Biol. (Stuttgart) 8(4): 486–493.

CCDB · ipcn-api-dl — Acosta. 2005. Karyotype analysis in several South American species of Solanum and Lycianthes rantonnei (Solanaceae). Taxon 54(3): 713–723.

TreeOfSex · plant — Goldblatt1979 ↗

n 122×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — acosta2005 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type254 records

Wild obs. + sensor9

Museum / vouchered217

Other28

Origin

Native74

Range

Area of Occupancy AOO444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 3≤1 km 2>10 km 2

7 georeferenced · 2 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5>10 km 4

9 georeferenced · 208 without coordinates

Open the institutions mapphysical evidence217

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	44
Porto Alegre, BR	33
UFMGlocation not on record	21
San Jose State University, Museum of Birds and Mammalslocation not on record	19
Istituto Agrario Castelnuovolocation not on record	13
UFOPlocation not on record	8
Chicago, US	7
Stockholm, SE	7
Blumenau, BR	6
USP-IBlocation not on record	6
JBRJlocation not on record	5
University of Stellenboschlocation not on record	4
South Kensington, GB	3
Kew, GB	3
Londrina, BR	3
PUC-RSlocation not on record	2
Universidade de São Paulolocation not on record	2
UnBlocation not on record	2
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	2
ASUlocation not on record	2
UNICAMPlocation not on record	2
UNESClocation not on record	2
Departamento de Geologia, Universidad de Chilelocation not on record	2
Corrientes, AR	1
Criciúma, BR	1
UFPRlocation not on record	1
FUVATESlocation not on record	1
CEPLAClocation not on record	1
ESALQlocation not on record	1
UNISANTAlocation not on record	1
Paris, FR	1
Badajoz, ES	1
Córdoba, AR	1
Santarém, BR	1
Cenargenlocation not on record	1
Brasília, BR	1
IPA/SPlocation not on record	1
Ivano-Frankivsk, UA	1
Universidade Federale do Rio Grande do Sullocation not on record	1
Saint Louis, US	1

40 institutions · 215 of 217 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Solanum vaillantii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)