Solanum umtuma — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records176

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Solanum umtuma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF176 records

DNA & barcodingNCBIsequences

01Narrative

Solanum umtuma is a species of plant in the Solanaceae family. The species is related to tomatoes. The species is andromonoecous. It can be found in South Africa in areas like Cape Province and KwaZulu-Natal.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum umtuma has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH283744.1 ↗597 bpSouth Africa

ACGT

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCGCGGCGTGGGGCGCTCCGGCGCCGCCCCGCGCGT …

Solanum umtuma voucher Nevhutalu 921 (K) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type176 records

Wild obs. + sensor118

Museum / vouchered41

Other17

Range

Area of Occupancy AOO564 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 79≤1 km 6≤10 km 6

91 georeferenced · 27 without coordinates

Open the mapobservation + sensor118

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 41 records without

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	28
Kew, GB	11
MeiseBGlocation not on record	1
South Kensington, GB	1

4 institutions · 41 of 41 vouchered records shown