Solanum torvum
Sw. · speciesAt a glance
Occurrence records14 808
Data sources13
Biological traits50
DNA specimens36
eDNA detections26
Sources13 archives
Databases and archives Solanum torvum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 808 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Chemical compositionLOTUS · NPASS166 compounds
Occurrence & distributionGBIF14 808 records
Environmental DNA1 datasets · 2 countries26 detections
DNA & barcodingBOLD · NCBI36 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.4 Gbp
01Narrative
Solanum torvum, l'Aubergine-pois, Fausse Aubergine, Aubergine sauvage, Bringelle marron ou Bélangère bâtarde, est une espèce de plantes de la famille des Solanaceae. Elle est notamment connue pour son utilisation comme porte-greffe pour l'aubergine.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology24
Fruit length12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 9.58 mm
Fruit length max11.5 mm
Fruit length min8 mm
Fruit width12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 9.58 mm
Fruit width max11.5 mm
Fruit width min8 mm
Leaf length125 mm
⚠ sources differ — AusTraits: 125 mm · GIFT: 108 mm
Leaf length max135 mm
Leaf length min80 mm
Leaf size23 760 mm²
Leaf width90 mm
⚠ sources differ — AusTraits: 90 mm · GIFT: 65 mm
Leaf width max87.5 mm
Leaf width min42.5 mm
Petiole length3.5 cm
Plant height1.8 m
⚠ sources differ — GIFT: 1.8 m · AusTraits: 3.5 m · TRY: 2 m
Plant height max2.75 m
Plant height min1 m
Seed length2 mm
Seed mass1.1 mg
Seed mass max1.15 mg
Seed mass min1 mg
Seed volume0.9 mm³
Seed volume max0.9 mm³
Seed volume min0.9 mm³
Life cycle & reproduction9
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering timeyyyyyynnnnnn
Life formshrub or tree
Life spanperennial
Pollination syndromebee
Raunkiær life formphanerophyte
Resprouting capacityfire_killed
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean925 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formtree
⚠ sources differ — GIFT: tree · AusTraits: shrub · TRY: Shrub
Habitat GIFTÁrea Antrópica, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Leaf shapeelliptical ovate
Succulenceno
Woodinesswoody
⚠ sources differ — TRY: W · AusTraits: woody · GIFT: variable
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition166 compounds
Compounds documented for Solanum torvum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Spirostane steroids22
Furostane steroids15
Cinnamic acids and derivatives6
Menthane monoterpenoids5
Fatty alcohols4
Documented compounds166 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-trans-Carveol | present | NPASS | |
| (1R,2S,3'R,4S,5'R,6S,7S,8R,9S,12S,13R,16S,18S,19S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-3',16,19-triol | present | LOTUS | |
| (1R,2S,4S,6R,7S,8R,9S,12S,13R,18S,19S)-19-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-one | present | LOTUS | |
| (1R,2S,4S,6R,7S,8R,9S,12S,13R,18S,19S)-19-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-one | present | LOTUS | |
| (1R,2S,4S,6R,7S,8R,9S,12S,13R,18S,19S)-19-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-one | present | LOTUS | |
| (1R,2S,4S,7S,8R,9S,12S,13R,16S,18S,19S)-16-hydroxy-19-[(2R,4R,5R,6R)-5-hydroxy-6-methyl-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-one | present | LOTUS | |
| (1R,2S,4S,7S,8R,9S,12S,13R,16S,18S,19S)-16-hydroxy-19-[(2R,4R,5R,6R)-5-hydroxy-6-methyl-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-one | present | LOTUS | |
| (1R,4R)-Dihydrocarvone | present | NPASS | |
| (1S,2R,4S,6R,7S,8R,9S,12R,13R,18S,19S)-19-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-one | present | LOTUS | |
| (1S,4R)-4-[(E,3R)-3-hydroxybut-1-enyl]-3,5,5-trimethylcyclohex-2-en-1-ol | present | NPASS |
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum torvum has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes7
GenBank sequences10
eDNA detections26
Countries2
The DNA barcodea real sequence read deposited for this species
GAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGTTACCAATATGTTTACTTCCATTGTAGGT …
Solanum torvum voucher MTMZU06 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcl) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK7★rbcL3★rbcLa★ITS★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Solanum torvum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 369 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Solanum torvum1.37 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records22–242n range24median24mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2414×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl +7
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Okoli, B. E. 1988. Cytotaxonomic study of five west African species of Solanum L. (Solanaceae). Feddes Repert. 99: 183–187.
CCDB · ipcn-api-dl — Karihaloo, J. L. 1991. Desynapsis due to temperature stress in three species of Solanum L. Cytologia 56: 603–611.
CCDB · ipcn-api-dl — Oyelana, O. A. & R. E. Ugborogho. 1997. Cytomorphological studies of four species of Solanum L. (Solanaceae) in Nigeria. Rev. Cytol. Biol. Vég., Bot. 20(3/4): 25–41.
CCDB · ipcn-api-dl — Bernardello, L. M., C. B. Heiser & M. Piazzano. 1994. Karyotypic studies in Solanum section Lasiocarpa (Solanaceae). Amer. J. Bot. 81(1): 95–103.
CCDB · book-ipcn67-71 — ROE, K. E. 1967. Chromosome numbers in some Solanaceae. Sida 3: 153-155.
CCDB · book-ipcn73-74 — FRITSCH, R. 1972. Chromosomenzahlen von Pflanzen der Insel Kuba. II. Kulturpflanze 19: 305-313.
CCDB · book-indian_vol1 — Bhaduri, P.N. 1933 ; Heiser, C.B. 1956; Rao, B.G.S. 1962, 1972; Bezbaruah, H.P. & Bezbaruah, B. 1963 ; Roe, K.E. 1967b ; Hsu, C.-C. 1968 ; Krishnappa, D.G. 1968, 1975 ; Von Reinhard, F. 1972 ; Pilz, G.B. 1980
CCDB · book-atlas-flowering-plants — Bhaduri 1933
CCDB · kew — Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 334: 309-345.
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — Goldblatt1979 ↗
2n 221×CCDB · kew
CCDB · kew — Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 334: 309-345.
n 1221×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +5
CCDB · solan
CCDB · ipcn-api-dl — Coleman, J. R. 1982. Chromosome numbers of Angiosperms collected in the state of São Paulo. Revista Brasil Genet. 5: 533–549.
CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA, U. Chatterjee & D. Hazra. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 576–579.
CCDB · ipcn-api-dl — Kumar, J. & A. Kumar/Sinha. 1989. Influence of distributional pattern on the reproductive mechanism and recombination system of solanaceous weeds. Glimpses Cytogenet. India 2: 62–67.
CCDB · ipcn-api-dl — Karihaloo, J. L. 1991. Desynapsis due to temperature stress in three species of Solanum L. Cytologia 56: 603–611.
CCDB · ipcn-api-dl — Gill, L. S. & A. O. Obembe. 1991. Chromosome studies in some trees and shrubs from S Nigeria. Willdenowia 21: 233–238.
CCDB · ipcn-api-dl — Oyelana, O. A. & R. E. Ugborogho. 1997. Cytomorphological studies of four species of Solanum L. (Solanaceae) in Nigeria. Rev. Cytol. Biol. Vég., Bot. 20(3/4): 25–41.
CCDB · ipcn-api-dl — Pilz, G. E. 1980. In Chromosome number reports LXVII. Taxon 29: 352–353.
CCDB · ipcn-api-dl — Whalen, M. D., D. E. Costich & C. B. Heiser. 1981. Taxonomy of Solanum sect. Lasiocarpa. Gentes Herb. 12: 41–129.
CCDB · book-ipcn72 — RAO, B.G.S. 1972. Morphology of the pachytene chromosomes of Solanum torvum. Econ. Sot. 26: 189-196.
CCDB · book-ipcn67-71 — KRISHNAPPA, D.G. 1968. Meiotic behaviour in non-tuberiferous species of Solanum. Cellule 67: 163-173.
CCDB · book-ipcn75-78 — Vasudevan 197 5
CCDB · Cave1956 — Heiser o
CCDB · Cave1963 — Heiser 1963a
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — bernardello1994|solsource ↗
TreeOfSex · plant — Goldblatt1979|coleman1982b|darcy1974|randell1976 ↗
n 243×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · solan
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytomorphological studies in some weedy species of the family Solanaceae from Jos Plateau, Nigeria. Feddes Repert. 101: 41–47.
CCDB · book-ipcn75-78 — Randell & Symon 1976
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type14 808 records
Wild obs. + sensor7 160
Museum / vouchered5 698
Cultivated / captive71
Other1 879
Origin
Native479
Introduced145
Range
Area of Occupancy AOO32 072 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy78% within 1 km
≤100 m 3 144≤1 km 754≤10 km 719>10 km 371
4 988 georeferenced · 2 172 without coordinates
Open the mapobservation + sensor7 160
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy71% within 1 km
≤100 m 791≤1 km 150≤10 km 284>10 km 96
1 321 georeferenced · 4 377 without coordinates
Open the institutions mapphysical evidence5 698
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 36>10 km 33
69 georeferenced · 2 without coordinates
Open the mapnot free-living71
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions127 of 263 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 874 |
| Durango, MX | 382 |
| Bronx, US | 310 |
| Kew, GB | 262 |
| Mexico City, MX | 232 |
| Brisbane, AU | 200 |
| South Kensington, GB | 191 |
| Beijing, CN | 133 |
| Tuxtla Gutiérrez, MX | 95 |
| National Biodiversity Institute, Costa Ricalocation not on record | 90 |
| Kunming, CN | 80 |
| Antiguo Cuscatlán, SV | 79 |
| Smithfield, AU | 78 |
| Paris, FR | 67 |
| MeiseBGlocation not on record | 63 |
| Guangzhou, CN | 54 |
| Berlin, DE | 53 |
| University of Stellenboschlocation not on record | 50 |
| WAGlocation not on record | 49 |
| León, NI | 47 |
| Tampa, US | 46 |
| Canberra, AU | 46 |
| Kathmandu, NP | 45 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 43 |
| Museo Entomologico de Leonlocation not on record | 41 |
| Universidad de Antioquia (UdeA)location not on record | 40 |
| Guilin, CN | 36 |
| Mérida, MX | 35 |
| Leiden University Medical Centerlocation not on record | 34 |
| Adelaide, AU | 34 |
| Yaoundé, CM | 31 |
| Tapachula, MX | 30 |
| LBVlocation not on record | 29 |
| Taipei, TW | 27 |
| Mount Annan, AU | 27 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 25 |
| Miami, US | 24 |
| Tuxtla Gutiérrez, MX | 24 |
| Herbier National du Gabonlocation not on record | 24 |
| Université de Strasbourglocation not on record | 23 |
| Blumenau, BR | 22 |
| Departamento de Sistematica e Ecologialocation not on record | 21 |
| Plocation not on record | 21 |
| Austin, US | 21 |
| University of Papua New Guinealocation not on record | 20 |
| Palmerston, AU | 20 |
| MEXUlocation not on record | 20 |
| Mexico City, MX | 19 |
| Taipei, TW | 19 |
| Chengdu, CN | 19 |
| Université du Lomélocation not on record | 19 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 19 |
| Yangling, CN | 18 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 18 |
| HNBlocation not on record | 18 |
| Chongqing Museumlocation not on record | 18 |
| Guatemala, GT | 16 |
| Chapingo, MX | 15 |
| Guiyang, CN | 15 |
| CJBGlocation not on record | 15 |
| UFMGlocation not on record | 15 |
| San Francisco de Campeche, MX | 14 |
| JBRJlocation not on record | 14 |
| San José, CR | 13 |
| Chicago, US | 13 |
| Bloomington, US | 13 |
| Taipei, TW | 13 |
| Honolulu, US | 12 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 12 |
| MAlocation not on record | 12 |
| CASlocation not on record | 11 |
| Edinburgh, GB | 11 |
| BMlocation not on record | 10 |
| Guatemala City, GT | 10 |
| Baroda, IN | 10 |
| Riverside, US | 9 |
| Xiamen, CN | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 9 |
| Ciudad de México, MX | 9 |
| Stockholm, SE | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Brussels, BE | 8 |
| Ilhéus, BR | 8 |
| CEPLAClocation not on record | 8 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 8 |
| Glocation not on record | 8 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 8 |
| Cambridge, US | 8 |
| James Cook Townsvillelocation not on record | 7 |
| Pretoria, ZA | 7 |
| Pondicherry, IN | 7 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 7 |
| Salvador, BR | 6 |
| Madison, US | 6 |
| Dresden, DE | 6 |
| Armidale, AU | 6 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 6 |
| Austin, US | 6 |
| UNICAMPlocation not on record | 6 |
| ASUlocation not on record | 6 |
| EL PASO, US | 6 |
| Kensington, AU | 6 |
| Auckland, NZ | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| Giardini Botanici Hanburylocation not on record | 5 |
| Odawara, JP | 5 |
| UFESlocation not on record | 5 |
| Mérida, MX | 5 |
| UnBlocation not on record | 5 |
| Culiacán, MX | 5 |
| TAIElocation not on record | 5 |
| Yunnan Universitylocation not on record | 5 |
| UFBAlocation not on record | 5 |
| Nanjing, CN | 4 |
| Porto Alegre, BR | 4 |
| Université National du Béninlocation not on record | 4 |
| Mexico City, MX | 4 |
| Altos de Pipe, VE | 4 |
| Sangmiung Universitylocation not on record | 4 |
| Managua, NI | 4 |
| BISHlocation not on record | 4 |
| USP-IBlocation not on record | 4 |
| Laboratorio de Ictiologialocation not on record | 4 |
| Changsha, CN | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| Wuhan, CN | 3 |
| Xining, CN | 3 |
| Elocation not on record | 3 |
| UTFPR-CPlocation not on record | 3 |
| Christchurch, NZ | 3 |
| Toronto, CA | 3 |
| UFRPElocation not on record | 3 |
| Campo Mourão, BR | 3 |
| Hanshan Normal Universitylocation not on record | 3 |
| La Trobe Universitylocation not on record | 3 |
| Jackson, US | 3 |
| Moscow State Universitylocation not on record | 3 |
| University of Zhejianglocation not on record | 3 |
| BRLUlocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Calabar, NG | 3 |
| Montréal, CA | 3 |
| Fort Worth, US | 3 |
| Frankfurt am Main | 3 |
| Cincinnati, US | 3 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| Loja, EC | 3 |
| Guangzhou, CN | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Escuela Agrícola Panamericanalocation not on record | 3 |
| Santiago de Cali, CO | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Guizhou Forestry Schoollocation not on record | 3 |
| Durban, ZA | 3 |
| Ivano-Frankivsk, UA | 3 |
| EAlocation not on record | 2 |
| Universidad de Nariño (UdeNar)location not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| Montecillo, Texcoco, MX | 2 |
| UFPElocation not on record | 2 |
| Pullman, US | 2 |
| University of Hamburglocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Guiyang, CN | 2 |
| The Maharaja Sayajirao University of Barodalocation not on record | 2 |
| LSF/FSA/UAClocation not on record | 2 |
| South China Normal Universitylocation not on record | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| LDlocation not on record | 2 |
| Limbe Botanical & Zoological Gardenslocation not on record | 2 |
| Guasave, MX | 2 |
| Gujarat Ayurved University, Government Ayurvedic College, Vadodaralocation not on record | 2 |
| Davis, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| CNF-UFHBlocation not on record | 2 |
| FPMZBlocation not on record | 2 |
| Toluca, MX | 2 |
| INMAlocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Southwest Forestry Collegelocation not on record | 2 |
| Santarém, BR | 2 |
| Xian, CN | 2 |
| OTSlocation not on record | 2 |
| UNIVILLElocation not on record | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| HUAlocation not on record | 2 |
| Universidade Paulistalocation not on record | 2 |
| Philadelphia, US | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| LISClocation not on record | 2 |
| San Francisco, US | 2 |
| Hobart, AU | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Njala Universitylocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| St. Paul, US | 1 |
| CMULlocation not on record | 1 |
| Jardim Botânico do Rio de Janeirolocation not on record | 1 |
| Clemson, US | 1 |
| Mexico City, MX | 1 |
| San Isidro, AR | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Chengdu, CN | 1 |
| Barcelona, ES | 1 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 1 |
| Lanzhou, CN | 1 |
| Gump Stationlocation not on record | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| Claremont, US | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| FLASlocation not on record | 1 |
| Brasília, BR | 1 |
| INBIOlocation not on record | 1 |
| Uppsala, SE | 1 |
| Cenargenlocation not on record | 1 |
| Mazatlán, MX | 1 |
| Phoenix, US | 1 |
| Coimbra, PT | 1 |
| ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record | 1 |
| Wellington, NZ | 1 |
| Goucher Collegelocation not on record | 1 |
| Cibinong, ID | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Minia, EG | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| San Angelo, US | 1 |
| Botanic Gardenlocation not on record | 1 |
| Monastir, TN | 1 |
| LGlocation not on record | 1 |
| M-VascularPlantslocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Fredericksburg, US | 1 |
| LSFlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| DSMlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Budapest, HU | 1 |
| Tuscaloosa, US | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Wlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Montpellier, FR | 1 |
| Clocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| National Pingtung University of Science and Technologylocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| UFAClocation not on record | 1 |
| Chaguaramas, TT | 1 |
| Brasília, BR | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| Zürich, CH | 1 |
263 institutions · 5 162 of 5 698 vouchered records shown · 536 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Solanum torvum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map2 countries0
Cultivated Habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.6 °C 22.2–27.0
Seasonal swing summer↔winter5.40 °C
Max temp (day)28.8 °C 28.0–32.4
Min temp (night)19.9 °C 16.6–22.7
Precipitation61.1 mm/mo 13.1–98.3
Air humidity61.3 % 51.1–65.4
Moisture balance-66.8 mm/mo -93.5–-53.9
Vapour deficit1,233 Pa 1,026–1,459
Wind speed2.00 m/s 1.60–3.50
Cloud cover26.0 % 14.0–58.7
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.