Solanum suaveolens

Kunth & C.D.Bouché · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records284

Data sources10

Biological traits11

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Solanum suaveolens's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility284 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS6 compounds

Occurrence & distributionGBIF284 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · TreeOfSex2n = 24

01Narrative

Solanum suaveolens là loài thực vật có hoa trong họ Cà. Loài này được Kunth & C.D. Bouché miêu tả khoa học đầu tiên năm 1848.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass0.359 mg

Life cycle & reproduction1

Life spanannual

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Elevation max2 300 m

Elevation min200 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Woodinessnon-woody

03Chemical composition6 compounds

Compounds documented for Solanum suaveolens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Steroidal alkaloids6

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,12S,13S,16S,18S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-5-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
Khasianine	present	LOTUS
Solamargine	present	LOTUS
Solasonine	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum suaveolens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKR872940.1 ↗613 bp

ACGT

GGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACGCGTTTCAACACTTGAGGGAGCCGCGCGGCTGGGGGGCCGAAGCTTCGT …

Solanum suaveolens isolate LB1357 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Solanum suaveolens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · book-ipcn72 · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn72 — VENKATESWARLU, J . & M.K. RAO. 1972. Breeding system, crossability relationships and isolating mechanisms in the Solanum nigrum complex. Cytologia 37: 317-326.

CCDB · book-ipcn67-71 — BRttCHER, H. 1970. Chromosomenzahlen argentinischer, chilenischer und venezolanischer Wildkartoffeln (Solanum, Sect. Tuberarium). Cytologia 35: 153-170.

CCDB · book-atlas-flowering-plants — Vilmorin & S. 1928

n 127×CCDB · solan · CCDB · book-ipcn75-78 · CCDB · Cave1958 +1

CCDB · solan

CCDB · book-ipcn75-78 — Anderson 1977

CCDB · book-ipcn75-78 — Anderson 1975

CCDB · Cave1958 — Baylis 1958

TreeOfSex · plant — floraperu|bernardello1990|anderson1977 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type284 records

Wild obs. + sensor3

Museum / vouchered243

Cultivated / captive5

Other33

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 33≤1 km 6≤10 km 15>10 km 1

55 georeferenced · 188 without coordinates

Open the institutions mapphysical evidence243

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	51
Bronx, US	37
Durango, MX	30
Elocation not on record	13
South Kensington, GB	11
Mexico City, MX	10
Kew, GB	8
Universiti Sains Malaysialocation not on record	6
Juriquilla, MX	6
Xiamen, CN	6
University of Stellenboschlocation not on record	5
Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record	5
NLD037location not on record	4
Universidad Nacional de Colombia (UNAL)location not on record	4
Edinburgh, GB	4
La Paz, BO	4
Aarhus, DK	3
Chicago, US	3
Cusco, PE	2
Dublin, IE	2
Universidad de Antioquia (UdeA)location not on record	2
HUT Culture Collectionlocation not on record	2
Cambridge, US	2
Tampa, US	1
Stockholm, SE	1
Göteborg, SE	1
Chapingo, MX	1
NO DISPONIBLElocation not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
BMlocation not on record	1
Tuxtla Gutiérrez, MX	1
San Isidro, AR	1
Santa Cruz de la Sierra, BO	1
QCNElocation not on record	1
Paris, FR	1
University of Zhejianglocation not on record	1

36 institutions · 233 of 243 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)