Solanum spirale

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records492

Data sources14

Biological traits40

DNA specimens2

eDNA detections2

Sources14 archives

Databases and archives Solanum spirale's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility492 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources40 traits

Chemical compositionLOTUS · NPASS79 compounds

Occurrence & distributionGBIF492 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Solanum spirale is a small fruiting shrub in the family Solanaceae, present in mid-elevation (500 to 1,900 m) paleotropical areas, in Southern China, India, Burma, Thailand, Laos, Vietnam, Indonesia and Australia (Queensland). It is widely cultivated in dooryard gardens in India, Thailand, and Laos and used for: food (cooked young leaves, raw or cooked berries) medicine (roots used as a narcotic and diuretic in Assam; bark macerate used as a febrifuge in Laos).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Fruit length12.5 mm

⚠ sources differ — AusTraits: 12.5 mm · GIFT: 7.5 mm

Fruit length max8 mm

Fruit length min7 mm

Fruit width12.5 mm

⚠ sources differ — AusTraits: 12.5 mm · GIFT: 7.5 mm

Fruit width max8 mm

Fruit width min7 mm

Leaf length125 mm

⚠ sources differ — AusTraits: 125 mm · GIFT: 145 mm

Leaf length max200 mm

Leaf length min70 mm

Leaf width22.5 mm

⚠ sources differ — AusTraits: 22.5 mm · GIFT: 60 mm

Leaf width max80 mm

Leaf width min20 mm

Petiole length1.75 cm

Plant height2.12 m

⚠ sources differ — GIFT: 2.12 m · AusTraits: 4 m · TRY: 3 m

Plant height max3 m

Plant height min0.5 m

Seed length3 mm

Seed width1 mm

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscenceindehiscent

Flowering timeyynnnnnnnnny

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 900 m

Elevation mean1 200 m

Elevation min500 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition79 compounds

Compounds documented for Solanum spirale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking🌿 Spice

Compound class profile5 classes

Quinoline alkaloids23

Illudalane sesquiterpenoids7

Steroidal alkaloids4

Isoquinoline alkaloids4

Simple coumarins3

Documented compounds79 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	NPASS
(+)-Simulanol	present	NPASS
(-)-Balanophonin	present	NPASS
(-)-Linalyl acetate	present	NPASS
(-)-Syringaresinol	present	NPASS
(2R)-2-[(3R)-3-hydroxy-4-methylpentyl]-2,6-dimethylpyrano[3,2-c]quinolin-5-one	present	NPASS
(2R)-2-[(3S,8S,9S,10R,13S,14S,16R,17R)-3,16-dihydroxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]-1-[(3S)-3-methyl-3,4-dihydro-2H-pyrrol-5-yl]propan-1-one	present	LOTUS
(2R)-2-[(E)-4-hydroperoxy-4-methylpent-2-enyl]-2,6-dimethylpyrano[3,2-c]quinolin-5-one	present	NPASS
(2R)-2-hydroxy-6-(2-hydroxyethyl)-2,5,7-trimethyl-3H-inden-1-one	present	NPASS
(2R,3R)-3-hydroxy-6-(2-hydroxyethyl)-2-(hydroxymethyl)-2,5,7-trimethyl-3H-inden-1-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum spirale has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMH718339.1 ↗437 bpThailand

ACGT

TGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCAGGCCGAGGGCACGTCTGCCTGGGCGTCAC …

Solanum spirale voucher WP002 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum spirale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–482n range36median24mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Kuriachan, P. & O. Mathew. 1988. Solanum spirale Roxb.: occurrence and cytology. Curr. Sci. 57: 506–507.

CCDB · book-ipcn67-71 — GERASIMENKO, I.I., & S.A. REZNIKOVA. 1968. A cytological investigation of the genus Solanum L. (In Russian) Bot. Zurn. 53: 505-513.

2n 483×CCDB · ipcn-api-dl · TreeOfSex · plant

CCDB · ipcn-api-dl — Gu, Z. & H. Sun. 1996. A cytological study of some plants from Qinghai-Xizang Plateau. Pp. 84--85 in International Symposium on Floristic Characteristics and Diversity of East Asian Plants July 25--27, 1996, Kunming, China: Abstracts. Botanical Society of China, Kunming.

CCDB · ipcn-api-dl — Gu, Z. j. & H. Sun. 1998. The chromosome report of some plants from Motuo, Xizang (Tibet). Acta Bot. Yunnan. 20(2): 207–210.

TreeOfSex · plant — Goldblatt1979 ↗

n 243×CCDB · solan · CCDB · book-ipcn75-78

CCDB · solan

CCDB · book-ipcn75-78 — Joshi in Randell & Symon 1976

n 121×TreeOfSex · plant

TreeOfSex · plant — Goldblatt1979|haegi1982|knapp2002b ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type492 records

Wild obs. + sensor38

Museum / vouchered440

Other14

Origin

Native20

Introduced2

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 20≤1 km 3≤10 km 2

25 georeferenced · 13 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 8≤1 km 8≤10 km 46>10 km 4

66 georeferenced · 374 without coordinates

Open the institutions mapphysical evidence440

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	109
Beijing, CN	75
Guangzhou, CN	35
Brisbane, AU	21
Mount Annan, AU	20
Guilin, CN	19
Yangling, CN	17
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	17
Nanjing, CN	15
Canberra, AU	11
Adelaide, AU	10
Guiyang, CN	8
Edinburgh, GB	7
Museo Entomologico de Leonlocation not on record	7
Kew, GB	7
Nishihara, JP	5
South Kensington, GB	4
Strecker Museum, Baylor Universitylocation not on record	4
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
CASlocation not on record	4
Bronx, US	3
Chengdu, CN	3
Armidale, AU	3
EMTCMlocation not on record	2
Saint Louis, US	2
Chengdu, CN	2
Fujian Institute of Subtropical Botanylocation not on record	1
South China Normal Universitylocation not on record	1
LDlocation not on record	1
Odawara, JP	1
Chengdu, CN	1
Jinghong, CN	1
Paris, FR	1
Guangzhou, CN	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Sagamihara, JP	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Wuhan, CN	1

38 institutions · 426 of 440 vouchered records shown · 14 without an institution code

09Environmental DNA2 detections

Where the DNA of Solanum spirale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 16.8–16.8

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.2 °C

Min temp (night)13.0 °C

Precipitation143 mm/mo

Air humidity64.1 %

Moisture balance44.7 mm/mo

Vapour deficit685 Pa

Wind speed2.80 m/s

Cloud cover24.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)