Solanum pyracanthos

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records68

Data sources4

Biological traits11

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Solanum pyracanthos's data was compiled from.

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources11 traits

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology1

Seed mass2.15 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Woodinessnon-woody

⚠ sources differ — TRY: H · AusTraits: woody · GIFT: non-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum pyracanthos has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSAY996546.1 ↗595 bp

ACGT

GGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCCCCCGCGCGCCTCCCCCTCGCCCCC …

Solanum pyracanthum voucher Olmstead S-95 WTU 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor29

Museum / vouchered39

Origin

Introduced1

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 4≤1 km 5≤10 km 3>10 km 9

21 georeferenced · 8 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 3

6 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	11
Saint Louis, US	8
Plocation not on record	5
Kew, GB	3
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	3
Museo Entomologico de Leonlocation not on record	2
BMlocation not on record	1
Davis, US	1
Brisbane, AU	1
Auckland, NZ	1
South Kensington, GB	1

11 institutions · 37 of 39 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)