Solanum pubescens

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records53

Data sources11

Biological traits10

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Solanum pubescens's data was compiled from.

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition19 compounds

Compounds documented for Solanum pubescens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols10

Steroidal alkaloids6

Ursane and Taraxastane triterpenoids1

Furocoumarins $ Simple coumarins1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,5S,7S,10S,11S,14S,15R,16S,17S,18S,20S,23S)-7-amino-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracosan-18-ol	present	LOTUS
7-Amino-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracosan-18-ol	present	LOTUS
[(3S,4aR,6aR,6aR,6bR,8aR,12S,12aR,14aR,14bR)-4,4,6a,6b,8a,12,14b-heptamethyl-11-methylidene-1,2,3,4a,5,6,6a,7,8,9,10,12,12a,13,14,14a-hexadecahydropicen-3-yl] hexadecanoate	present	NPASS
Astragalin	present	LOTUS
Ayanin	present	LOTUS
Jaranol	present	LOTUS
Kaempferol	present	LOTUS
Kaempferol 3-O-alpha-L-rhamnoside-beta-D-glucosyl	present	LOTUS
Myricetin 3,7,3',5'-tetramethyl ether	present	LOTUS
Myricetin 3,7,3'-trimethyl ether	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum pubescens has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKU719937.1 ↗594 bp

ACGT

GGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGAGCCGCGCGGCGGGGGCGTTCCTGCGCCGCC …

Solanum pubescens voucher Sampath Kumar et al. 975a (MH) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum pubescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Tree of Sex Database · CCDB · book-ipcn65 · CCDB · book-indian_vol1 +2

GoaT · Tree of Sex Database — ↗

CCDB · book-ipcn65 — Chennaveer. & K. 1965

CCDB · book-indian_vol1 — Krishnaswamy, N. et al. 1954 ; Bezbaruah, H. P. & Bezbaruah, B. 1963 ; Krishnappa, D.G. 1968

CCDB · Cave1963 — Bez. & Bez. 1963

TreeOfSex · plant — Goldblatt1979 ↗

n 122×CCDB · book-ipcn67-71 · CCDB · Cave1963

CCDB · book-ipcn67-71 — KRISHNAPPA, D.G. 1968. Meiotic behaviour in non-tuberiferous species of Solanum. Cellule 67: 163-173.

CCDB · Cave1963 — Bez. & Bez. 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type53 records

Wild obs. + sensor28

Museum / vouchered16

Cultivated / captive4

Other5

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy46% within 1 km

≤100 m 3≤1 km 3≤10 km 5>10 km 2

13 georeferenced · 15 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence16

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 3

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	6
Museo Entomologico de Leonlocation not on record	3
Uppsala, SE	2
Kew, GB	1

4 institutions · 12 of 16 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Solanum pubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)