Solanum pseudocapsicum
speciesAt a glance
Occurrence records14 933
Data sources16
Biological traits68
DNA specimens27
eDNA detections17
Sources16 archives
Databases and archives Solanum pseudocapsicum's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 933 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources68 traits
Chemical compositionLOTUS · NPASS71 compounds
Occurrence & distributionGBIF14 933 records
Environmental DNA1 datasets · 4 countries17 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex1.1 Gbp
01Narrative
Dried fruits with seeds of Solanum pseudocapsicum. Solanum pseudocapsicum is a nightshade species with mildly poisonous fruit."Medicinal and Poisonous Plants of Southern and Eastern Africa" - Watt & Brandwijk (E&S Livingstone, 1962) It is commonly known as the Jerusalem cherry, Madeira winter cherry, or, ambiguously, "winter cherry". These perennials can be grown decoratively as house plants, but in some areas of South Africa, India, Australia and New Zealand it is regarded as a weed.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology28
Fruit length12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 14.5 mm
Fruit length max15 mm
Fruit length min10 mm
Fruit width12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 14.17 mm
Fruit width max20 mm
Fruit width min8 mm
Leaf length65 mm
⚠ sources differ — AusTraits: 65 mm · GIFT: 35 mm
Leaf length max115 mm
Leaf length min10 mm
Leaf width12.5 mm
⚠ sources differ — AusTraits: 12.5 mm · GIFT: 32 mm
Leaf width max44 mm
Leaf width min5 mm
Petiole length1.5 cm
Plant height1.1 m
⚠ sources differ — GIFT: 1.1 m · AusTraits: 2 m · TRY: 0.65 m
Plant height max2.5 m
Plant height min0.3 m
Seed length3 mm
Seed length max2.75 mm
Seed length min2.75 mm
Seed mass2.87 mg
Seed mass max3.53 mg
Seed mass min2.36 mg
Seed volume12 mm³
Seed volume max12 mm³
Seed volume min12 mm³
Seed width3 mm
⚠ sources differ — AusTraits: 3 mm · GIFT: 2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourorange
Flower width max15 mm
Flower width min10 mm
Flowering endOct
Flowering startDec
Flowering timennnnnnnnnnny
Life formsubshrub or shrub
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourorange
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
Habitat GIFTÁrea Antrópica, Campo Limpo, Cerrado (lato sensu), Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista, Restinga
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapelanceolate oblong
Mycorrhiza typePh.th.end.
Woodinesswoody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)25.22 mm²/mg
Other traits2
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition71 compounds
Compounds documented for Solanum pseudocapsicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Steroidal alkaloids13
Dihydroflavonols7
Stigmastane steroids4
Cadinane sesquiterpenoids4
Acyclic monoterpenoids3
Documented compounds71 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Betulonic acid | present | NPASS | |
| (+)-Erythrodiol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (+)-Yangambin | present | NPASS | |
| (-)-Isopulegol | present | NPASS | |
| (1R,2S,4R)-2-Hydroxy-alpha,alpha,4-trimethylcyclohexanemethanol | present | NPASS | |
| (1R,4S,4aR,7S,8aR)-1,6-dimethyl-4-propan-2-yl-3,4,4a,7,8,8a-hexahydro-2H-naphthalene-1,7-diol | present | NPASS | |
| (1S,2R,3S,5R,7S,10S,11S,14S,15R,16S,17R,20R,22S,24R)-7-amino-22-methoxy-10,14,16,20-tetramethyl-23-oxa-18-azahexacyclo[12.11.0.02,11.05,10.015,24.017,22]pentacosan-3-ol | present | LOTUS | |
| (1S,2R,5S,7S,10S,11S,14S,15R,16S,17R,20R,22S,24R)-22-methoxy-10,14,16,20-tetramethyl-23-oxa-18-azahexacyclo[12.11.0.02,11.05,10.015,24.017,22]pentacosan-7-amine | present | LOTUS | |
| (1S,2S,20S,42S,46R)-7,8,9,12,13,14,25,26,27,30,31,32,35,36,37,46-hexadecahydroxy-3,18,21,41,43-pentaoxanonacyclo[27.13.3.138,42.02,20.05,10.011,16.023,28.033,45.034,39]hexatetraconta-5,7,9,11,13,15,23,25,27,29(45),30,32,34(39),35,37-pentadecaene-4,17,22,40,44-pentone | present | NPASS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum pseudocapsicum has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences7
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
AACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGCACGACCCGCGAACGCGTTCAAACACCGGGGGC …
Solanum pseudocapsicum voucher 179 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS2rpoBtrnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Solanum pseudocapsicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 075 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Solanum pseudocapsicum1.08 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–242n range24median24mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2422×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn65 +8
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · book-ipcn65 — Kawano 1965
CCDB · ipcn-api-dl — Chennaveeraiah, M. S. & D. G. Krishnappa. 1971. Karyomorphological studies in nonspinaceous species of Solanum. J. Cytol. Genet. 5: 89–94.
CCDB · ipcn-api-dl — Huang, S. f., Z. f. Zhao, Z. y. Chen, S. j. Chen & X. x. Huang. 1989. Chromosome counts on one hundred species and infraspecific taxa. Acta Bot. Austro Sin. 5: 161–176.
CCDB · ipcn-api-dl — Liu, D. z. & L. Li. 1992. The karyotype analysis of Solanum pseudocapsicum. Chin. Bull. Bot. 9(3): 50.
CCDB · ipcn-api-dl — Acosta. 2005. Karyotype analysis in several South American species of Solanum and Lycianthes rantonnei (Solanaceae). Taxon 54(3): 713–723.
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1927a, 1928 ; Bezbaruah, H.P. & BezQaruah, B. 1963 ; Kawano, S. 1965 ; Baquar, S.R. 1967a ; Madhavadian, P. 1968 ; Gill, L.S. 1971e ; Sarkar, A.K., Datta, N. eta!. 1978
CCDB · book-indian_vol1 — Bir, S.S., Kumari, S. et ~1. 1978
CCDB · book-fedorov — Jorgensen 192&
CCDB · book-fedorov — Vilmorin, Simonet
CCDB · book-fedorov — Huskins, La Cour 1930
CCDB · book-fedorov — Sugiura f931, 1936b
CCDB · book-atlas-flowering-plants — Vilmorin & S. 1928
CCDB · book-atlas-flowering-plants — H
CCDB · kew — Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 334: 309-345.
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — Goldblatt1979 ↗
n 1217×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · solan
CCDB · ipcn-api-dl — Moscone, E. A. 1992. Estudios de cromosomas meióticos en Solanaceae de Argentina. Darwiniana 31: 261–297.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · book-ipcn67-71 — GILL, L.S. 1971. Chromosome numbers in certain West-Himalayan bicarpellate species. Bull. Torrey Bot. Club 98: 281.
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Sarker et al. 1978
CCDB · book-ipcn75-78 — Randell & Symon 1976
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · Cave1963 — Bez. & Bez. 1963
TreeOfSex · plant — Goldblatt1979|darcy1974|acosta2005|randell1976|knapp2002b|solsource ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~2.79 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.79 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type14 933 records
Wild obs. + sensor11 740
Museum / vouchered2 813
Cultivated / captive92
Other288
Origin
Native360
Introduced2 269
Range
Area of Occupancy AOO32 196 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 7 252≤1 km 1 204≤10 km 656>10 km 184
9 296 georeferenced · 2 444 without coordinates
Open the mapobservation + sensor11 740
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 147≤1 km 138≤10 km 230>10 km 54
569 georeferenced · 2 244 without coordinates
Open the institutions mapphysical evidence2 813
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 92 records without
Open the mapnot free-living92
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions138 of 259 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 258 |
| Saint Louis, US | 223 |
| Porto Alegre, BR | 126 |
| Pretoria, ZA | 96 |
| Blumenau, BR | 92 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 82 |
| Córdoba, AR | 80 |
| Mount Annan, AU | 79 |
| Museo Entomologico de Leonlocation not on record | 74 |
| Odawara, JP | 67 |
| Brisbane, AU | 62 |
| Paleontological Collectionlocation not on record | 58 |
| Canberra, AU | 51 |
| San Isidro, AR | 44 |
| South Kensington, GB | 40 |
| Chicago, US | 38 |
| Durango, MX | 35 |
| Adelaide, AU | 33 |
| Santa Cruz de la Sierra, BO | 29 |
| Christchurch, NZ | 28 |
| Auckland, NZ | 28 |
| Universidad Nacional de Asunciónlocation not on record | 28 |
| Chiba, JP | 26 |
| UFMGlocation not on record | 26 |
| Durban, ZA | 25 |
| Sucre, BO | 25 |
| Universidade Federale do Rio Grande do Sullocation not on record | 24 |
| UTFPR-CPlocation not on record | 23 |
| Seoul, KR | 23 |
| Corrientes, AR | 23 |
| UNESClocation not on record | 22 |
| Mexico City, MX | 22 |
| Austin, US | 21 |
| Campo Mourão, BR | 20 |
| Criciúma, BR | 20 |
| Armidale, AU | 18 |
| Kew, GB | 18 |
| Smithfield, AU | 18 |
| JBRJlocation not on record | 17 |
| PUC-RSlocation not on record | 16 |
| Chengdu, CN | 16 |
| TAIElocation not on record | 14 |
| Beijing, CN | 14 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 13 |
| Taipei, TW | 13 |
| Universidad de Antioquia (UdeA)location not on record | 13 |
| La Paz, BO | 12 |
| Nanjing, CN | 12 |
| FUVATESlocation not on record | 12 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 11 |
| Ivano-Frankivsk, UA | 11 |
| Yangling, CN | 11 |
| Hobart, AU | 10 |
| MAlocation not on record | 10 |
| Istituto Agrario Castelnuovolocation not on record | 10 |
| Wellington, NZ | 10 |
| BIO-UNIPIlocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| INTAlocation not on record | 9 |
| Cape Town, ZA | 9 |
| Nanchong, CN | 8 |
| Bando, JP | 8 |
| FJIDClocation not on record | 8 |
| Sanda, JP | 8 |
| US | 8 |
| Changsha, CN | 7 |
| Yunnan Universitylocation not on record | 7 |
| Kochi, JP | 7 |
| Tsukuba, JP | 7 |
| Universidad de Caldas (UCaldas)location not on record | 7 |
| Taipei, TW | 7 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| Ciudad de México, MX | 7 |
| Paris, FR | 7 |
| Cenargenlocation not on record | 7 |
| Batemans Bay, AU | 6 |
| Brasília, BR | 6 |
| Taipei, TW | 6 |
| Wollongong, AU | 6 |
| SLU Artdatabankenlocation not on record | 6 |
| BDBClocation not on record | 6 |
| Rotorua, NZ | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| UEMlocation not on record | 6 |
| Tampa, US | 6 |
| South African National Biodiversity Institute, The National Herbariumlocation not on record | 6 |
| Stockholm, SE | 5 |
| Nagasaki University - Fisherieslocation not on record | 5 |
| Guiyang, CN | 5 |
| Jiujiang Forestry Institutelocation not on record | 5 |
| Wuhan, CN | 5 |
| Kathmandu, NP | 5 |
| Salamanca, ES | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Bangkok, TH | 5 |
| Bloomington, US | 5 |
| Brasília, BR | 5 |
| Canadian Department of Agriculturelocation not on record | 4 |
| UnBlocation not on record | 4 |
| UDESC-CAVlocation not on record | 4 |
| Sagamihara, JP | 4 |
| KURAlocation not on record | 4 |
| Tokushima, JP | 4 |
| Cascavel, BR | 4 |
| Lake Charles, US | 4 |
| Bern, CH | 4 |
| Berlin, DE | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| BISHlocation not on record | 4 |
| LDlocation not on record | 4 |
| Zhengzhou, CN | 3 |
| Honolulu, US | 3 |
| UFSClocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| BMlocation not on record | 3 |
| UNIVILLElocation not on record | 3 |
| UTFPR-SLlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 3 |
| UNICAMPlocation not on record | 3 |
| St. Augustine, TT | 3 |
| UFMSlocation not on record | 3 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 3 |
| Wlocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| UFPRlocation not on record | 3 |
| Clemson, US | 3 |
| Pelotas, BR | 3 |
| BAYLUlocation not on record | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| USP-IBlocation not on record | 3 |
| Dublin, IE | 3 |
| Badajoz, ES | 2 |
| Columbia, US | 2 |
| MeiseBGlocation not on record | 2 |
| San Diego, US | 2 |
| CASlocation not on record | 2 |
| Guangzhou, CN | 2 |
| Universidade Paulistalocation not on record | 2 |
| GAlocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Santarém, BR | 2 |
| UFESlocation not on record | 2 |
| Tomioka, JP | 2 |
| Londrina, BR | 2 |
| Wuhan, CN | 2 |
| UTFPR-DVlocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Plocation not on record | 2 |
| Cambridge, US | 2 |
| UFSMlocation not on record | 2 |
| Anchorage, US | 2 |
| Tuscaloosa, US | 2 |
| Toluca, MX | 2 |
| Davis, US | 2 |
| Pondicherry, IN | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| Riverside, US | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| La Trobe Universitylocation not on record | 2 |
| València, ES | 2 |
| Masindi, UG | 2 |
| UNESP-RClocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| GZUlocation not on record | 2 |
| Guiyang, CN | 1 |
| QVMAGlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| IAvHlocation not on record | 1 |
| Jaén, ES | 1 |
| Northridge, US | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Guasave, MX | 1 |
| Vitoria, ES | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Los Angeles, US | 1 |
| BClocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Pamplona, ES | 1 |
| Santa Maria, BR | 1 |
| Barcelona, ES | 1 |
| Guiyang, CN | 1 |
| MEXUlocation not on record | 1 |
| Uppsala, SE | 1 |
| Granada, ES | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| National Pingtung University of Science and Technologylocation not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| UFOPlocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Portland, US | 1 |
| Guangzhou, CN | 1 |
| Vietnam National Museum of Naturelocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| ESP026location not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Québec, CA | 1 |
| HUAlocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Pullman, US | 1 |
| Guilin, CN | 1 |
| Minia, EG | 1 |
| Frankfurt am Main | 1 |
| Williamsburg, US | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Nagano City, JP | 1 |
| Universität Göttingenlocation not on record | 1 |
| Austin, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Mississippi State, US | 1 |
| Osaka, JP | 1 |
| Kensington, AU | 1 |
| Parkville, AU | 1 |
| Salzburg, AT | 1 |
| Bogotá, D.C., CO | 1 |
| UESBlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Muzaffarabad, PK | 1 |
| Cape Town, ZA | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| ASUlocation not on record | 1 |
| Göteborg, SE | 1 |
| Staten Island, US | 1 |
| La Paz, MX | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| UNICENTRO-IRATIlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Ilhéus, BR | 1 |
| University of Nevada, Museum of Biologylocation not on record | 1 |
| Fort Worth, US | 1 |
| Madison, US | 1 |
| College Park, US | 1 |
| Wuzhou, CN | 1 |
| Guatemala, GT | 1 |
| INMAlocation not on record | 1 |
259 institutions · 2 785 of 2 813 vouchered records shown · 25 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Solanum pseudocapsicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map4 countries0
Subtropical forestSavanna grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.4 °C 14.5–20.0
Seasonal swing summer↔winter12.3 °C
Max temp (day)21.7 °C 18.9–25.9
Min temp (night)10.7 °C 9.30–14.7
Precipitation85.1 mm/mo 16.8–141
Air humidity58.3 % 45.3–63.3
Moisture balance-28.0 mm/mo -100–0.4
Vapour deficit804 Pa 669–1,120
Wind speed3.10 m/s 2.60–5.30
Cloud cover29.9 % 14.6–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.