Solanum nigrum
speciesAt a glance
Occurrence records266 954
Data sources12
Biological traits78
DNA specimens198
eDNA detections103
Sources12 archives
Databases and archives Solanum nigrum's data was compiled from.
GBIFGlobal Biodiversity Information Facility266 953 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI103 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics198 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources78 traits
Chemical compositionNPASS119 compounds
Occurrence & distributionGBIF · PBDB266 954 records
Environmental DNA2 datasets · 16 countries103 detections
DNA & barcodingBOLD · NCBI198 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex3.6 Gbp
Deep timePBDB1 fossils
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology29
Fruit length7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 7.57 mm
Fruit length max8 mm
Fruit length min8 mm
Fruit width7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 7.73 mm
Fruit width max8 mm
Fruit width min5 mm
Leaf length70 mm
⚠ sources differ — AusTraits: 70 mm · GIFT: 62.5 mm
Leaf length max140 mm
Leaf length min10 mm
Leaf mass39.17 mg
Leaf size4 000 mm²
⚠ sources differ — AusTraits: 4 000 mm² · LEDA: 1 272 mm² · GIFT: 1 272 mm²
Leaf width50 mm
⚠ sources differ — AusTraits: 50 mm · GIFT: 35 mm
Leaf width max70 mm
Leaf width min15 mm
Petiole length2 cm
Plant height0.531 m
⚠ sources differ — GIFT: 0.531 m · AusTraits: 1 m · LEDA: 0.5 m · TRY: 0.738 m
Plant height generative0.3 m
Plant height max1.5 m
Plant height min0.05 m
Seed length1.54 mm
⚠ sources differ — TRY: 1.54 mm · AusTraits: 2 mm · GIFT: 1 mm
Seed mass0.961 mg
⚠ sources differ — TRY: 0.961 mg · AusTraits: 0.25 mg · LEDA: 0.785 mg · GIFT: 0.788 mg
Seed mass max1.22 mg
Seed mass min0.23 mg
Seed volume0.597 mm³
Seed volume max1.9 mm³
Seed volume min0.014 mm³
Seed width2 mm
Seed width max2 mm
Seed width min2 mm
Life cycle & reproduction19
Deciduousnessevergreen
⚠ sources differ — TRY: E · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flowering endOct
Flowering startJun
Flowering timennnnnyyyynnn
Life formannual or perennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: short_lived_perennial · LEDA: annuals · GIFT: annual
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityfire_killed
Seed number9 020
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment18
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 600 m
Elevation mean2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourblack
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: herb
Habitat GIFTdense secondary shrub and ruderal vegetation
Leaf compoundnesssimple
Leaf formovate
Leaf shapeovate
Mycorrhiza typearbuscular
Succulenceno
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody · LEDA: non-woody · GIFT: non-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)140 mg/g
⚠ sources differ — TRY: 140 mg/g · LEDA: 132 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)27.76 mm²/mg
⚠ sources differ — TRY: 27.76 mm²/mg · LEDA: 22 mm²/mg · GIFT: 25.23 mm²/mg
Wood density257 mg/cm³
Other traits4
Diaspore typefruit
Leaf arrangementalternate
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition119 compounds
Compounds documented for Solanum nigrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Flavan-3-ols11
Furofuranoid lignans11
Steroidal alkaloids10
Cinnamic acids and derivatives8
Flavonols4
Documented compounds119 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Epigallocatechin | present | NPASS | |
| (+)-Pinoresinol | present | NPASS | |
| (+)-Syringaresinol | present | NPASS | |
| (-)-Catechol | present | NPASS | |
| (-)-Pinoresinol | present | NPASS | |
| (-)-Syringaresinol | present | NPASS | |
| (2R,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| (3R,5S,6S)-6,10-dimethyl-3-prop-1-en-2-ylspiro[4.5]dec-9-en-8-one | present | NPASS | |
| (R)-naringenin | present | NPASS | |
| (S)-Naringenin | present | NPASS |
05DNA & barcoding198 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum nigrum has left across the world's sequence archives.
At a glance
DNA specimens198
Marker genes10
GenBank sequences10
eDNA detections103
Countries16
The DNA barcodea real sequence read deposited for this species
GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCG …
Solanum nigrum voucher ikiu 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK4★rbcL4★rbcLa★trnL-F★ITS2★ITS1★ITS2rpoBtrnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Solanum nigrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 628 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Solanum nigrum3.63 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 72 n = 36
Ploidy6× hexaploid · measured
Chromosome records24–722n range48median72mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 722×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
2n 241×GoaT · Tree of Sex Database
GoaT · Tree of Sex Database — ↗
2n 421×GoaT · Tree of Sex Database
GoaT · Tree of Sex Database — ↗
2n 481×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — GERASIMENKO, I.I., & S.A. REZNIKOVA. 1968. A cytological investigation of the genus Solanum L. (In Russian) Bot. Zurn. 53: 505-513.
n 123×CCDB · solan · CCDB · ipcn-api-dl · TreeOfSex · plant
CCDB · solan
CCDB · ipcn-api-dl — Moscone, E. A. 1992. Estudios de cromosomas meióticos en Solanaceae de Argentina. Darwiniana 31: 261–297.
TreeOfSex · plant — wagner1999 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99% BUSCO
07Deep time11.6–5.33 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range11.6–5.33 Ma Miocene
Dated fossil finds1
StatusNot recorded since 5.33 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Solanum nigrum. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type266 954 records
Wild obs. + sensor248 187
Museum / vouchered17 208
Cultivated / captive224
Fossil1
Other1 334
Origin
Native12 263
Introduced22 608
Range
Area of Occupancy AOO384 188 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 50 044≤1 km 36 505≤10 km 119 935>10 km 2 464
208 948 georeferenced · 39 239 without coordinates
Open the mapobservation + sensor248 187
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 1 498≤1 km 2 051≤10 km 2 933>10 km 468
6 950 georeferenced · 10 258 without coordinates
Open the institutions mapphysical evidence17 208
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 2≤10 km 11>10 km 31
44 georeferenced · 180 without coordinates
Open the mapnot free-living224
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions265 of 548 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 2 097 |
| Uniwersytet Wrocławskilocation not on record | 756 |
| Adelaide, AU | 693 |
| Beijing, CN | 569 |
| LDlocation not on record | 497 |
| Chengdu, CN | 466 |
| BIO-UNIPIlocation not on record | 463 |
| Olocation not on record | 451 |
| South Kensington, GB | 372 |
| Museo Entomologico de Leonlocation not on record | 269 |
| Moscow State Universitylocation not on record | 225 |
| MeiseBGlocation not on record | 224 |
| Philadelphia, US | 203 |
| Berlin, DE | 202 |
| Kensington, AU | 195 |
| Mount Annan, AU | 188 |
| Yangling, CN | 180 |
| Canberra, AU | 170 |
| Brisbane, AU | 161 |
| Oskarshamn, SE | 157 |
| Odawara, JP | 152 |
| Uppsala, SE | 152 |
| Oregon State Universitylocation not on record | 149 |
| Durango, MX | 146 |
| Nanjing, CN | 136 |
| Auckland, NZ | 126 |
| Uniwersytet Warszawskilocation not on record | 115 |
| Chongqing Museumlocation not on record | 114 |
| Pretoria, ZA | 111 |
| Wuhan, CN | 108 |
| Nagano City, JP | 108 |
| Hobart, AU | 103 |
| Taipei, TW | 101 |
| KMNlocation not on record | 100 |
| Adam Mickiewicz University in Poznańlocation not on record | 99 |
| Turku, FI | 87 |
| València, ES | 84 |
| BFLlocation not on record | 83 |
| Sanda, JP | 82 |
| SLU Artdatabankenlocation not on record | 82 |
| Chengdu, CN | 81 |
| MAlocation not on record | 81 |
| Chiba, JP | 80 |
| Bronx, US | 79 |
| Wellington, NZ | 72 |
| Baroda, IN | 69 |
| Tartu, EE | 69 |
| Christchurch, NZ | 69 |
| Bergen, NO | 68 |
| Bern, CH | 67 |
| Palmerston, AU | 67 |
| Allentown, US | 62 |
| Kunming, CN | 61 |
| Salzburg, AT | 60 |
| Kew, GB | 58 |
| Guilin, CN | 58 |
| Oulu, FI | 57 |
| Central China Normal Universitylocation not on record | 54 |
| Paris, FR | 53 |
| Trondheim, NO | 50 |
| Dresden, DE | 49 |
| TUR-Alocation not on record | 48 |
| Tsukuba, JP | 48 |
| Armidale, AU | 46 |
| San Diego, US | 46 |
| Görlitz, DE | 46 |
| Taipei, TW | 45 |
| National Institute of Biological Resourceslocation not on record | 45 |
| Wlocation not on record | 44 |
| Toyama, JP | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| BClocation not on record | 41 |
| College of the Atlantic, Museumlocation not on record | 41 |
| TAIElocation not on record | 40 |
| NSMKlocation not on record | 40 |
| University of Stellenboschlocation not on record | 38 |
| Riverside, US | 38 |
| CICYTEXlocation not on record | 37 |
| Seoul, KR | 37 |
| lbglocation not on record | 36 |
| Yaoundé, CM | 36 |
| Badajoz, ES | 35 |
| Bloomington, US | 33 |
| Kochi, JP | 33 |
| New Haven, US | 32 |
| Tokushima, JP | 31 |
| CASlocation not on record | 31 |
| BDBClocation not on record | 31 |
| St. Paul, US | 31 |
| National Herbarium & Botanic Gardens of Malawilocation not on record | 30 |
| UIBlocation not on record | 30 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Zhengzhou, CN | 29 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 29 |
| Mexico City, MX | 28 |
| WTUlocation not on record | 28 |
| Nishihara, JP | 28 |
| Xining, CN | 27 |
| Guangzhou, CN | 27 |
| Durban, ZA | 26 |
| Entomological Society of Latvialocation not on record | 25 |
| UGentlocation not on record | 25 |
| Claremont, US | 25 |
| Universidad de Caldas (UCaldas)location not on record | 24 |
| Frankfurt am Main | 23 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 23 |
| Bando, JP | 23 |
| Tomioka, JP | 23 |
| University of New Hampshirelocation not on record | 23 |
| Saint Louis, US | 22 |
| Barcelona, ES | 22 |
| BRNUlocation not on record | 22 |
| Shinshu Universitylocation not on record | 22 |
| Strecker Museum, Baylor Universitylocation not on record | 21 |
| Salamanca, ES | 20 |
| Shanghai, CN | 20 |
| Philadelphia, US | 20 |
| Wuhan, CN | 20 |
| WNNUlocation not on record | 20 |
| Institute for Biology of National Academy of Sci.location not on record | 19 |
| Sagamihara, JP | 19 |
| University of Wisconsinlocation not on record | 18 |
| Otaru, JP | 18 |
| Alicante, ES | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Québec, CA | 18 |
| Cape Town, ZA | 18 |
| Guangzhou, CN | 18 |
| Phyletisches Museum Jenalocation not on record | 18 |
| Hazara Universitylocation not on record | 18 |
| Université de Strasbourglocation not on record | 17 |
| College Park, US | 17 |
| Nanchong, CN | 17 |
| Lanzhou, CN | 17 |
| Mexico City, MX | 17 |
| JP | 17 |
| Valparaiso, CL | 17 |
| Fukushima Universitylocation not on record | 16 |
| Sevilla, ES | 16 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 16 |
| Rotorua, NZ | 16 |
| Tallinn, EE | 16 |
| Vancouver, CA | 16 |
| National Museums of Kenyalocation not on record | 16 |
| Davis, US | 15 |
| KURAlocation not on record | 15 |
| GMBAlocation not on record | 15 |
| Moscow, US | 15 |
| Universidad Industrial de Santander (UIS)location not on record | 15 |
| Nishihara, JP | 15 |
| Xiamen, CN | 15 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Chapingo, MX | 15 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| Jardín Botánico de Bogotá "José Celestino Mutis" (JBB)location not on record | 14 |
| Corvallis, US | 14 |
| Granada, ES | 14 |
| TROMlocation not on record | 14 |
| Bangkok, TH | 14 |
| Córdoba, ES | 14 |
| Provincia di Livornolocation not on record | 14 |
| SXTCMlocation not on record | 14 |
| Taipei, TW | 14 |
| KIRMlocation not on record | 13 |
| Leiden University Medical Centerlocation not on record | 13 |
| Smithfield, AU | 13 |
| Jyväskylä, FI | 13 |
| Uniwersytet Śląski w Katowicachlocation not on record | 13 |
| Kushiro City Museumlocation not on record | 13 |
| Awka, NG | 13 |
| Acadia Universitylocation not on record | 13 |
| Universidad de La Salle (La Salle)location not on record | 12 |
| 盐城国家级珍禽自然保护区location not on record | 12 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 12 |
| Dekalb, US | 12 |
| Fort Worth, US | 12 |
| Austin, US | 12 |
| Santa Barbara, US | 12 |
| Guiyang, CN | 12 |
| San Luis Obispo, US | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Mérida, MX | 12 |
| GJOlocation not on record | 12 |
| UChlocation not on record | 11 |
| Chengdu, CN | 11 |
| Nagatoro-machi, Chichibu-gun, JP | 11 |
| Helsinki, FI | 11 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 11 |
| Vitoria, ES | 11 |
| Provo, US | 11 |
| Rishon Le Zion, IL | 11 |
| New Brunswick, US | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| Madrid, ES | 10 |
| Korea National Arboretumlocation not on record | 10 |
| 云南省思茅市民族传统医药研究所location not on record | 10 |
| SZUlocation not on record | 10 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 9 |
| ENTClocation not on record | 9 |
| Parkville, AU | 9 |
| Universidad de Nariño (UdeNar)location not on record | 9 |
| Chapel Hill, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Staten Island, US | 9 |
| Zürich, CH | 9 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 9 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 9 |
| Bozeman, US | 9 |
| Denver, US | 8 |
| Edinburgh, GB | 8 |
| QVMAGlocation not on record | 8 |
| Pocatello, US | 8 |
| Jaén, ES | 8 |
| Universidad Nacional de Colombia (UNAL)location not on record | 8 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 8 |
| Tacoma, US | 8 |
| Xian, CN | 8 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 8 |
| Portland, US | 8 |
| Pullman, US | 8 |
| Albuquerque, US | 8 |
| KOMlocation not on record | 8 |
| Akita Prefectural Museumlocation not on record | 8 |
| Tuxtla Gutiérrez, MX | 7 |
| Université Lavallocation not on record | 7 |
| La Trobe Universitylocation not on record | 7 |
| Hangzhou, CN | 7 |
| Changsha, CN | 7 |
| Natural History Museum Rotterdamlocation not on record | 7 |
| PRClocation not on record | 7 |
| Yunnan Universitylocation not on record | 7 |
| Porrentruy, CH | 7 |
| Frauenfeld, CH | 6 |
| Montréal, CA | 6 |
| Flagstaff, US | 6 |
| Pamplona, ES | 6 |
| Guiyang, CN | 6 |
| IDElocation not on record | 6 |
| Palmerston North, NZ | 6 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 6 |
| McWane Science Centerlocation not on record | 6 |
| Jiujiang Forestry Institutelocation not on record | 6 |
| Osaka, JP | 6 |
| Xinxiang, CN | 6 |
| Los Angeles, US | 6 |
| Pondicherry, IN | 6 |
| Urumqi, CN | 6 |
| HNBlocation not on record | 6 |
| Phoenix, US | 6 |
| NMBU:MINAlocation not on record | 6 |
| Wuzhou, CN | 6 |
| TAFORI-LSRClocation not on record | 6 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 6 |
| Hudson, US | 6 |
| Obihiro Centennial City Museumlocation not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| CNF-UFHBlocation not on record | 6 |
| Servico de Microbiologia e Imunologialocation not on record | 6 |
| BAYLUlocation not on record | 5 |
| Irvine, US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| US | 5 |
| HUFDlocation not on record | 5 |
| Burlington, US | 5 |
| GHPG$location not on record | 5 |
| Boise, US | 5 |
| UNESP-FCAlocation not on record | 5 |
| Hermosillo, MX | 5 |
| Dehra Dun, IN | 5 |
| J.F.Oberlin Universitylocation not on record | 5 |
| Hiratsuka City Museumlocation not on record | 5 |
| CJBGlocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| Batemans Bay, AU | 5 |
| Miami, US | 5 |
| Mérida, MX | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| DNSMlocation not on record | 5 |
| Sendai, JP | 5 |
| Logan, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| FJFClocation not on record | 4 |
| ASUlocation not on record | 4 |
| Bourges, FR | 4 |
| Chongqing Natural History Museumlocation not on record | 4 |
| Severin-McDaniel Insect Collectionlocation not on record | 4 |
| Shanghai, CN | 4 |
| EL PASO, US | 4 |
| Arcata, US | 4 |
| Shanxi Institute of Biologylocation not on record | 4 |
| Tapachula, MX | 4 |
| Viña del Mar, CL | 4 |
| Iwate Prefectural Museumlocation not on record | 4 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 4 |
| KIWElocation not on record | 4 |
| Nanjing, CN | 4 |
| Pamplona, ES | 4 |
| Sevilla, ES | 4 |
| Universidad Católica de Oriente (UCO)location not on record | 4 |
| Glarus, CH | 4 |
| South African National Biodiversity Institute, The National Herbariumlocation not on record | 4 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 4 |
| ZRC-SAZUlocation not on record | 4 |
| Stockholm, SE | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| Kagoshima, JP | 4 |
| Nijmegen, NL | 4 |
| Wollongong, AU | 4 |
| Forssa, FI | 4 |
| University of Johannesburglocation not on record | 4 |
| Smithsonian Institutionlocation not on record | 4 |
| Université du Lomélocation not on record | 4 |
| NSW Office of Environment and Heritagelocation not on record | 4 |
| Waverly, US | 4 |
| Juriquilla, MX | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Davenport, US | 4 |
| Columbia, US | 4 |
| Victoria, CA | 3 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 3 |
| BSBIlocation not on record | 3 |
| Toronto, CA | 3 |
| Madison, US | 3 |
| FFPRIlocation not on record | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| SJNAlocation not on record | 3 |
| JBSlocation not on record | 3 |
| Valparaíso, CL | 3 |
| Göteborg, SE | 3 |
| Philadelphia, US | 3 |
| Gijón, ES | 3 |
| Jiangxi College of Educationlocation not on record | 3 |
| Mississippi State, US | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Mexico City, MX | 3 |
| Jishou Universitylocation not on record | 3 |
| Kuopio, FI | 3 |
| Plocation not on record | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| Northridge, US | 3 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| LBVlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Salvador, BR | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Guatemala City, GT | 3 |
| Zürich, CH | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Grand Junction, US | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Angwin, US | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Sharjah Seed Bank & Herbariumlocation not on record | 3 |
| Peking Universitylocation not on record | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Missoula, US | 3 |
| US | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Toyota city nature sanctuarylocation not on record | 2 |
| Stephenville, US | 2 |
| CIBIOlocation not on record | 2 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 2 |
| GZUlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Chicago, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 2 |
| Saint John, CA | 2 |
| Washington, US | 2 |
| EEZA-CSIClocation not on record | 2 |
| Cuenca, EC | 2 |
| Tula State Universitylocation not on record | 2 |
| South China Normal Universitylocation not on record | 2 |
| Tilburg, NL | 2 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 2 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 2 |
| Joondalup, AU | 2 |
| Altos de Pipe, VE | 2 |
| ISAlocation not on record | 2 |
| Cambridge, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Fulda, DE | 2 |
| Sion, CH | 2 |
| CRSN_LWIROlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Zhuzhou, CN | 2 |
| PrivatHerblocation not on record | 2 |
| Corporación Universitaria Santa Rosa de Cabal (UNISARC)location not on record | 2 |
| University of Zhejianglocation not on record | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| Santiago, CL | 2 |
| FLADlocation not on record | 2 |
| Jackson, US | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Herbier National du Gabonlocation not on record | 2 |
| Mlocation not on record | 2 |
| Santa Cruz, US | 2 |
| Montecillo, Texcoco, MX | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Kingston, US | 2 |
| BGPAlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Guasave, MX | 1 |
| Ashland, US | 1 |
| Oswego, US | 1 |
| USFSlocation not on record | 1 |
| National Herbarium of São Tomé and Principelocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| IAvHlocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Urumqi, CN | 1 |
| Ensenada, MX | 1 |
| JGSlocation not on record | 1 |
| San José, CR | 1 |
| UTPLlocation not on record | 1 |
| Glocation not on record | 1 |
| Dipartimento di Scienze della Vita dell'Università degli Studi di Trieste | Department of Life Sciences of the University of Triestelocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| CMULlocation not on record | 1 |
| EAlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| EFGlocation not on record | 1 |
| Maringá, BR | 1 |
| LSF/FSA/UAClocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Knox Collegelocation not on record | 1 |
| National Pingtung University of Science and Technologylocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| 武陵山动植物研究所location not on record | 1 |
| DSMlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| LINUlocation not on record | 1 |
| Córdoba, AR | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Dover, US | 1 |
| AUAlocation not on record | 1 |
| Firenze, IT | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| UNESClocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 1 |
| Arusha, TZ | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Elocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Xian, CN | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| GB | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| EMTCMlocation not on record | 1 |
| Lubbock, US | 1 |
| IMMUlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Qufu Normal Universitylocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Porvoo, FI | 1 |
| Winterthur, CH | 1 |
| Sapporo, JP | 1 |
| JMSlocation not on record | 1 |
| Millersville, US | 1 |
| IATMlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| AASlocation not on record | 1 |
| INMAlocation not on record | 1 |
| University of Port Harcourtlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Austin, US | 1 |
| GNWPlocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Boumlocation not on record | 1 |
| Puebla, MX | 1 |
| ESP109location not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Honolulu, US | 1 |
| Namur, BE | 1 |
| ESP027location not on record | 1 |
| San Isidro, AR | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| RBGlocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| Brasília, BR | 1 |
| Pittsburg, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| ESP003location not on record | 1 |
| LfUlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| US | 1 |
| Henderson, US | 1 |
| Ann Arbor, US | 1 |
| Tlalnepantla, MX | 1 |
| NLD037location not on record | 1 |
| La Sierra Universitylocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Fargo, US | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Denton, US | 1 |
| KNAMlocation not on record | 1 |
| AZE014location not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Criciúma, BR | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Caldwell, US | 1 |
| nbflocation not on record | 1 |
| University of Hargeisalocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| KR | 1 |
| Long Beach, US | 1 |
| Chicago, US | 1 |
| Durham, US | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Dublin, IE | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
548 institutions · 16 168 of 17 208 vouchered records shown · 966 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA103 detections
Where the DNA of Solanum nigrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found103
Studies independent surveys2
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 103 detections have coordinates
Open the map16 countries0
Rhus integrifolia, Malosma, Ricinus, Raphanu…Savanna grasslandRed soil savanna bushland.Found in rocky strem area,growing near phyll…weed in front garden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 12.5–21.9
Seasonal swing summer↔winter13.6 °C
Max temp (day)23.9 °C 16.5–27.4
Min temp (night)12.8 °C 8.20–16.1
Precipitation50.4 mm/mo 9.00–118
Air humidity56.8 % 49.1–63.7
Moisture balance-64.3 mm/mo -127–41.8
Vapour deficit920 Pa 564–1,264
Wind speed2.80 m/s 1.90–4.70
Cloud cover30.6 % 13.6–48.6
CHELSA 1981–2010, ~9 km grid, at location & month of 75 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.