Solanum mauritianum
Scop. · speciesAt a glance
Occurrence records31 787
Data sources13
Biological traits65
DNA specimens34
eDNA detections21
Sources13 archives
Databases and archives Solanum mauritianum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility31 787 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources65 traits
Chemical compositionLOTUS · NPASS14 compounds
Occurrence & distributionGBIF31 787 records
Environmental DNA2 datasets · 3 countries21 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24
01Narrative
Solanum mauritianum, appelé localement Bringellier marron, Tabac marron ou Faux tabac, est une espèce de plantes dicotylédones de la famille des Solanaceae, originaire d'Amérique du Sud. Ce sont des arbustes pouvant atteindre 5 mètres de haut dont les fruits sont des baies globuleuses jaunes à maturité. Toutes les parties de la plante sont toxiques.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology23
Fruit length13.5 mm
⚠ sources differ — AusTraits: 13.5 mm · GIFT: 10 mm
Fruit width13.5 mm
⚠ sources differ — AusTraits: 13.5 mm · GIFT: 10 mm
Fruit width max15 mm
Leaf length200 mm
Leaf length max350 mm
Leaf length min90 mm
Leaf mass per area43.2 g/m2
Leaf width80 mm
⚠ sources differ — AusTraits: 80 mm · GIFT: 70 mm
Leaf width max140 mm
Leaf width min35 mm
Petiole length6 cm
Plant height5.5 m
⚠ sources differ — GIFT: 5.5 m · AusTraits: 4 m · TRY: 4.5 m
Plant height max10 m
Plant height min1 m
Seed length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass1.07 mg
Seed mass max1.03 mg
Seed mass min1.02 mg
Seed volume1.9 mm³
Seed volume max1.9 mm³
Seed volume min1.9 mm³
Life cycle & reproduction18
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourpurple
Flower width max20 mm
Flowering endJun
Flowering startApr
Flowering timennyyyyyyyyyn
Life formshrub or tree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityresprouts
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max1 510 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourorange
Fruit fleshinessfleshy
Fruit typeberry
Growth formtree
⚠ sources differ — GIFT: tree · AusTraits: shrub tree
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Estacional Decidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical
Mycorrhiza typearbuscular
Succulenceno
Woodinesswoody
Physiology & chemistry3
Leaf n50 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits3
Leaf arrangementalternate
Plant support typefree-standing
Seeds per fruit>1000
03Chemical composition14 compounds
Compounds documented for Solanum mauritianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Iridoids monoterpenoids6
Cinnamic acids and derivatives $ Phenylethanoids2
Spirostane steroids1
Cinnamic acids and derivatives1
Steroidal alkaloids1
Documented compounds14 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-3-Octanol | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-6-[(1R,2S,3'S,4S,5'S,6S,7S,8R,9S,10R,12S,13R,16S)-3',10-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4,5-dihydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | NPASS | |
| 1D-myo-inositol 1,2,3,4,5,6-hexakisphosphate | present | LOTUS | |
| 6-O-Caffeoylarbutin | present | NPASS | |
| [(2R,3S,4R,5R,6R)-2-[[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-4,5-dihydroxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | NPASS | |
| [(2R,3S,4R,5R,6R)-2-[[(2R,3R,4S,5R,6S)-3,4-dihydroxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoyl]oxymethyl]oxan-2-yl]oxyoxan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-4,5-dihydroxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | NPASS | |
| Aucubin | present | NPASS | |
| Catalpol | present | NPASS | |
| Catalposide | present | NPASS | |
| hydroquinone-O-β-D-glucopyranoside | present | NPASS |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum mauritianum has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes5
GenBank sequences8
eDNA detections21
Countries3
The DNA barcodea real sequence read deposited for this species
TCGAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGGGGGCGCGCGGCGGGGGTGCTTCGGCCCCCCCGCCCCGCGCCTCC …
Solanum mauritianum voucher voucher_Olmstead_S90_(WTU) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS3trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Solanum mauritianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 246×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +1
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Chennaveeraiah, M. S. & D. G. Krishnappa. 1971. Karyomorphological studies in nonspinaceous species of Solanum. J. Cytol. Genet. 5: 89–94.
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1928 ; Krishnappa, D.G. 1968 ; Madhavadian, P. 1968
TreeOfSex · plant — Goldblatt1979 ↗
n 127×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · solan
CCDB · ipcn-api-dl — Coleman, J. R. 1982. Chromosome numbers of Angiosperms collected in the state of São Paulo. Revista Brasil Genet. 5: 533–549.
CCDB · book-ipcn67-71 — KRISHNAPPA, D.G. 1968. Meiotic behaviour in non-tuberiferous species of Solanum. Cellule 67: 163-173.
CCDB · book-ipcn75-78 — Barlow in Randell & Symon 1976
TreeOfSex · plant — Goldblatt1979|coleman1982b|darcy1974|randell1976 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type31 787 records
Wild obs. + sensor29 276
Museum / vouchered2 088
Cultivated / captive158
Other265
Origin
Native401
Introduced4 725
Range
Area of Occupancy AOO45 804 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 16 422≤1 km 2 935≤10 km 2 236>10 km 1 036
22 629 georeferenced · 6 647 without coordinates
Open the mapobservation + sensor29 276
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 135≤1 km 123≤10 km 200>10 km 43
501 georeferenced · 1 587 without coordinates
Open the institutions mapphysical evidence2 088
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 1
2 georeferenced · 156 without coordinates
Open the mapnot free-living158
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 162 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Blumenau, BR | 151 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 142 |
| Brisbane, AU | 114 |
| Porto Alegre, BR | 108 |
| Pretoria, ZA | 96 |
| Mount Annan, AU | 91 |
| Canberra, AU | 66 |
| Auckland, NZ | 62 |
| Durban, ZA | 61 |
| Bronx, US | 55 |
| Kew, GB | 53 |
| Adelaide, AU | 53 |
| Smithfield, AU | 51 |
| Christchurch, NZ | 48 |
| Museo Entomologico de Leonlocation not on record | 45 |
| Saint Louis, US | 37 |
| Ivano-Frankivsk, UA | 36 |
| Armidale, AU | 29 |
| Paris, FR | 27 |
| UNESClocation not on record | 27 |
| JBRJlocation not on record | 26 |
| Istituto Agrario Castelnuovolocation not on record | 25 |
| Wellington, NZ | 25 |
| UFMGlocation not on record | 25 |
| UTFPR-CPlocation not on record | 23 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 23 |
| Cape Town, ZA | 22 |
| Criciúma, BR | 19 |
| Campo Mourão, BR | 18 |
| UNICAMPlocation not on record | 17 |
| MeiseBGlocation not on record | 16 |
| Universidade Federale do Rio Grande do Sullocation not on record | 15 |
| PUC-RSlocation not on record | 14 |
| FUVATESlocation not on record | 14 |
| Chicago, US | 12 |
| Riverside, US | 11 |
| Canadian Department of Agriculturelocation not on record | 11 |
| Plocation not on record | 11 |
| Pontifícia Universidade Católica do Paranálocation not on record | 10 |
| John T. Waterhouse Herbariumlocation not on record | 10 |
| South Kensington, GB | 10 |
| South African National Biodiversity Institute, The National Herbariumlocation not on record | 9 |
| Foz do Iguaçu, BR | 9 |
| UEMlocation not on record | 9 |
| Rotorua, NZ | 9 |
| Wollongong, AU | 8 |
| UFPRlocation not on record | 8 |
| Cascavel, BR | 8 |
| Londrina, BR | 8 |
| Hobart, AU | 7 |
| INMAlocation not on record | 7 |
| IAPlocation not on record | 7 |
| Tampa, US | 6 |
| Instituto de Investigação Científica Tropicallocation not on record | 6 |
| Claremont, US | 6 |
| UNIVILLElocation not on record | 6 |
| Brasília, BR | 5 |
| UFSClocation not on record | 5 |
| UDESC-CAVlocation not on record | 5 |
| Batemans Bay, AU | 5 |
| IPA/SPlocation not on record | 5 |
| MAlocation not on record | 5 |
| Santarém, BR | 5 |
| USP-IBlocation not on record | 4 |
| National Museum of Natural Sciencelocation not on record | 4 |
| UNESP-FCAlocation not on record | 4 |
| University of Stellenboschlocation not on record | 4 |
| Odawara, JP | 4 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 4 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 4 |
| Davis, US | 4 |
| Université de Strasbourglocation not on record | 4 |
| Stockholm, SE | 4 |
| Dresden, DE | 4 |
| UnBlocation not on record | 4 |
| UNESP-RClocation not on record | 3 |
| UTFPR-DVlocation not on record | 3 |
| UTFPR-SLlocation not on record | 3 |
| Santa Maria, BR | 3 |
| ASUlocation not on record | 3 |
| Honolulu, US | 3 |
| UFOPlocation not on record | 3 |
| CASlocation not on record | 3 |
| Uberlândia, BR | 3 |
| James Cook Townsvillelocation not on record | 3 |
| TAIElocation not on record | 3 |
| UFBAlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Cenargenlocation not on record | 3 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| BDBClocation not on record | 2 |
| Palmerston, AU | 2 |
| Ural Federal University "B. N. Yeltsin"location not on record | 2 |
| Los Angeles, US | 2 |
| Barcelona, ES | 2 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 2 |
| UFMSlocation not on record | 2 |
| Masindi, UG | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Pondicherry, IN | 2 |
| Brasília, BR | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Cruz das Almas, BR | 2 |
| Badajoz, ES | 2 |
| Pelotas, BR | 2 |
| UFESlocation not on record | 2 |
| Universidade Tecnológica Federal do Paranálocation not on record | 2 |
| San Diego, US | 2 |
| University of Johannesburglocation not on record | 2 |
| Provo, US | 1 |
| BISHlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Glocation not on record | 1 |
| Yaoundé, CM | 1 |
| Córdoba, AR | 1 |
| ISAlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Northridge, US | 1 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 1 |
| Sendai, JP | 1 |
| WAGlocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Feira de Santana, BR | 1 |
| Flagstaff, US | 1 |
| ESALQlocation not on record | 1 |
| Facultad de Agronomía - Universidad de la Repúblicalocation not on record | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| UEPAlocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Salvador, BR | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| Lake Charles, US | 1 |
| Miami, US | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Porto Velho, BR | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Vancouver, CA | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| MVJBlocation not on record | 1 |
| CEPLAClocation not on record | 1 |
| UFSCarlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Chaguaramas, TT | 1 |
| Moscow State Universitylocation not on record | 1 |
| Maringá, BR | 1 |
| Universidade Paulistalocation not on record | 1 |
| UFRPElocation not on record | 1 |
| Dublin, IE | 1 |
| Bloomington, US | 1 |
| Philadelphia, US | 1 |
| UFSJlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| US | 1 |
| BMlocation not on record | 1 |
162 institutions · 2 042 of 2 088 vouchered records shown · 44 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Solanum mauritianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys2
Countries3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map3 countries0
Savanna grasslandSubtropical forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.9 °C 8.90–21.0
Seasonal swing summer↔winter12.8 °C
Max temp (day)21.9 °C 17.1–26.7
Min temp (night)10.4 °C 1.80–14.6
Precipitation31.1 mm/mo 6.10–104
Air humidity52.8 % 43.9–62.8
Moisture balance-58.6 mm/mo -106–-0.5
Vapour deficit804 Pa 580–1,145
Wind speed3.00 m/s 2.50–4.50
Cloud cover14.7 % 7.80–31.6
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.