Solanum macrocarpon

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records730

Data sources13

Biological traits21

DNA specimens12

eDNA detections9

Sources13 archives

Databases and archives Solanum macrocarpon's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS144 compounds

Occurrence & distributionGBIF730 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24

01Narrative

Solanum macrocarpon est une plante vivace tropicale de la famille des solanacées, étroitement apparentée à l'aubergine. Cette espèce est originaire d'Afrique de l'Ouest. Mais elle est maintenant largement distribuée en Afrique centrale et orientale. Elle a aussi été introduite dans les Caraïbes, en Amérique du Sud et dans certaines parties de l'Asie du Sud-Est, ce qui lui confère une importance socio-économique croissante dans le monde. S. macrocarpon est largement cultivé pour son utilisation comme nourriture, mais aussi pour certains usages médicinaux voire comme plante ornementale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1.5 m

Plant height max1.52 m

Plant height min0.5 m

Seed mass3.32 mg

Seed mass max3.3 mg

Seed mass min3.3 mg

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 525 m

Elevation min35 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition144 compounds

Compounds documented for Solanum macrocarpon across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Piperidine alkaloids7

Steroidal alkaloids5

Branched fatty acids3

Pimarane and Isopimarane diterpenoids2

Amino cyclitols $ Aminoglycosides1

Documented compounds144 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Nonactic acid	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-6-hydroxy-2-(hydroxymethyl)-4-[(1S,2R,3'S,4S,5'R,6S,7S,8R,9S,12R,13R,16S)-3'-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-6-hydroxy-4-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5'-(hydroxymethyl)-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-2-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4S,5R,6R)-4-hydroxy-2-(hydroxymethyl)-6-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-4-[(1S,2R,3'S,4S,5'R,6S,7S,8R,9S,12R,13R,16S)-3'-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-2-[(2R,3R,4S,5R,6R)-2,3,5-trihydroxy-6-(hydroxymethyl)oxan-4-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(3S,6S)-3,6-Bis-(4-Hydroxy-Benzyl)-1,4-Dimethyl-Piperazine-2,5-Dione	present	NPASS
(s)-10-Methyldodecanoic acid	present	NPASS
12-Methyltridecanoic acid	present	NPASS
18-Hydroxyoctadecanoic acid	present	NPASS

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum macrocarpon has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes6

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOR053562.1 ↗325 bpNigeria

ACGT

ACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAA …

Solanum macrocarpon isolate NGB00277 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK3★rbcL7★rbcLa★trnL-F★ITS

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum macrocarpon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–362n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Omidiji, M. O. 1983. Cytomorphological studies of Solanum aethiopicum x Solanum macrocarpon F1 hybrid. Cytologia 48: 35–40.

CCDB · ipcn-api-dl — Ugborogho, R. E. 1983. In IOPB chromosome number reports LXXIX. Taxon 32: 321.

TreeOfSex · plant — Goldblatt1979 ↗

2n 361×CCDB · Cave1962

CCDB · Cave1962 — Mige 1962

n 124×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — Goldblatt1979|bukeny1995|omidiji1979|solsource ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type730 records

Wild obs. + sensor149

Museum / vouchered193

Cultivated / captive145

Other243

Range

Area of Occupancy AOO1 516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 23≤1 km 5≤10 km 3>10 km 10

41 georeferenced · 108 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 19>10 km 1

20 georeferenced · 173 without coordinates

Open the institutions mapphysical evidence193

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 142 without coordinates

Open the mapnot free-living145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	23
NLD037location not on record	19
MeiseBGlocation not on record	15
Durban, ZA	14
Yaoundé, CM	12
Saint Louis, US	10
Paris, FR	7
HNBlocation not on record	7
ESP026location not on record	7
Bronx, US	4
South Kensington, GB	3
Université du Lomélocation not on record	3
Xiamen, CN	2
WAGlocation not on record	2
Herbier National du Gabonlocation not on record	2
South African National Biodiversity Institutelocation not on record	1
CMULlocation not on record	1
Dresden, DE	1
Uberlândia, BR	1
University of Johannesburglocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Chongqing Museumlocation not on record	1
University of Stellenboschlocation not on record	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
LBVlocation not on record	1
Arusha, TZ	1
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	1

27 institutions · 142 of 193 vouchered records shown · 51 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA9 detections

Where the DNA of Solanum macrocarpon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 20.7–21.4

Seasonal swing summer↔winter6.00 °C

Max temp (day)24.2 °C 22.7–25.7

Min temp (night)18.0 °C 16.0–20.0

Precipitation64.6 mm/mo 31.2–98.0

Air humidity59.3 % 57.6–61.1

Vapour deficit1,010 Pa 985–1,035

Cloud cover19.1 % 12.9–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)