Solanum lyratum
Thunb. · speciesAt a glance
Occurrence records4 083
Data sources13
Biological traits28
DNA specimens6
eDNA detections6
Sources13 archives
Databases and archives Solanum lyratum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 083 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics6 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources28 traits
Chemical compositionLOTUS · NPASS46 compounds
Occurrence & distributionGBIF4 083 records
Environmental DNA1 datasets · 0 countries6 detections
DNA & barcodingBOLD · NCBI6 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex2n = 24
01Narrative
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology17
Fruit length8 mm
Fruit length max8 mm
Fruit length min8 mm
Fruit width8 mm
Fruit width max8 mm
Fruit width min8 mm
Leaf length45 mm
Leaf length max55 mm
Leaf length min35 mm
Leaf width max48 mm
Leaf width min25 mm
Plant height1.38 m
Plant height max1 m
Plant height min0.5 m
Seed mass0.94 mg
Seed mass max0.94 mg
Seed mass min0.94 mg
Life cycle & reproduction3
Deciduousnessdeciduous
Life formscrambling shrub or liana
Life spanperennial
Habitat & environment7
Climatetemperate
Climberobligatory
Elevation max2 800 m
Elevation mean1 700 m
Elevation min600 m
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Climber
Woodinessnon-woody
Physiology & chemistry1
Nitrogen fixingnon_nitrogen_fixer
03Chemical composition46 compounds
Compounds documented for Solanum lyratum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Steroidal alkaloids8
Eudesmane sesquiterpenoids4
Cholestane steroids $ Spirostane steroids3
Apocarotenoids(ε-)3
Pterocarpan3
Documented compounds46 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dehydrovomifoliol | present | LOTUS | |
| (1R,2R,4aR,6S,8aS)-6-[(2S)-1,2-dihydroxypropan-2-yl]-8a-methyl-4-methylidene-1,2,3,4a,5,6,7,8-octahydronaphthalene-1,2-diol | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[(2R)-4-[(1S,2S,4S,6R,7S,8R,9S,12S,13R,16S)-16-[(2R,3R,4S,5R,6R)-5-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[(2R,3R,4S,5R,6R)-5-[(2S,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-4-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[(2S,3R,4S,5R,6R)-2-[(2R,3R,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,8S,9S,10R,13S,14S,16S,17R)-17-[(2S,3R,6R)-3,7-dihydroxy-6-methylheptan-2-yl]-16-hydroxy-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (3beta,5alpha)-3-Hydroxypregn-16-en-20-one | present | LOTUS | |
| (3R)-6-[(3R,4S)-4,7-dihydroxy-3,4-dihydro-2H-chromen-3-yl]-2,2-dimethyl-3,4-dihydrochromene-3,5-diol | present | LOTUS | |
| (3R,4S)-3-(2-hydroxy-4-methoxyphenyl)-3,4-dihydro-2H-chromene-4,7-diol | present | LOTUS | |
| (3R,4S)-3-(5-hydroxy-2,2-dimethylchromen-6-yl)-3,4-dihydro-2H-chromene-4,7-diol | present | LOTUS |
05DNA & barcoding6 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum lyratum has left across the world's sequence archives.
At a glance
DNA specimens6
Marker genes4
GenBank sequences10
eDNA detections6
Countries1
The DNA barcodea real sequence read deposited for this species
TCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCA …
Solanum lyratum var. lyratum I-83 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · TreeOfSex
The complete instruction manual Solanum lyratum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 245×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant
GoaT · Tree of Sex Database — ↗
CCDB · ipcn-api-dl — Ge, C. j., Y. k. Li, P. Wan & P. s. Hsu. 1989. Chromosome numbers of 31 medicinal plants from Shandong Province. Pp. 267--272 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Ge, C. j. & Y. x. Li. 1990. Karyotype analysis of Solanum lyratum Thunb. J. Shandong Coll. Traditional Chin. Med. 14: 55–57.
CCDB · ipcn-api-dl — Yang, D. k. 2001. Chromosome studies of six species of plants from Shandong. J. Shandong Norm. Univ., Nat. Sci. Ed. 16(3): 305–312.
TreeOfSex · plant — Goldblatt1979 ↗
n 122×CCDB · solan · TreeOfSex · plant
CCDB · solan
TreeOfSex · plant — xianghui2011 ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 083 records
Wild obs. + sensor1 945
Museum / vouchered2 093
Other45
Origin
Native8
Range
Area of Occupancy AOO9 548 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 345≤1 km 118≤10 km 44>10 km 57
564 georeferenced · 1 381 without coordinates
Open the mapobservation + sensor1 945
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy20% within 1 km
≤100 m 1≤1 km 25≤10 km 100>10 km 4
130 georeferenced · 1 963 without coordinates
Open the institutions mapphysical evidence2 093
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 115 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 189 |
| Odawara, JP | 154 |
| Nanjing, CN | 124 |
| Yangling, CN | 110 |
| Guangzhou, CN | 89 |
| Sanda, JP | 82 |
| Nagano City, JP | 76 |
| Shinshu Universitylocation not on record | 66 |
| Central China Normal Universitylocation not on record | 52 |
| Chiba, JP | 50 |
| Kochi, JP | 48 |
| Taipei, TW | 45 |
| Bando, JP | 43 |
| Nagatoro-machi, Chichibu-gun, JP | 41 |
| Hangzhou, CN | 37 |
| Toyama, JP | 36 |
| Kunming, CN | 36 |
| Chengdu, CN | 35 |
| NSMKlocation not on record | 34 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 29 |
| National Institute of Biological Resourceslocation not on record | 28 |
| South Kensington, GB | 28 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 24 |
| KR | 24 |
| Tsukuba, JP | 23 |
| Guilin, CN | 23 |
| Changsha, CN | 22 |
| Nishihara, JP | 21 |
| Wuhan, CN | 21 |
| KURAlocation not on record | 21 |
| Tomioka, JP | 20 |
| Taipei, TW | 20 |
| JP | 18 |
| Tokushima, JP | 18 |
| Chengdu, CN | 18 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 18 |
| Taipei, TW | 18 |
| Hunan Hupingshan National Nature Reservelocation not on record | 15 |
| Shanghai, CN | 14 |
| Bronx, US | 13 |
| Guangzhou, CN | 12 |
| WNNUlocation not on record | 12 |
| Guiyang, CN | 12 |
| 盐城国家级珍禽自然保护区location not on record | 12 |
| Sagamihara, JP | 10 |
| Zhengzhou, CN | 10 |
| Wuhan, CN | 10 |
| Lanzhou, CN | 10 |
| Sendai, JP | 9 |
| Akita Prefectural Museumlocation not on record | 9 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 9 |
| Seoul, KR | 8 |
| Fukushima Universitylocation not on record | 8 |
| Xining, CN | 8 |
| Ishikawa Museum of Natural Historylocation not on record | 8 |
| J.F.Oberlin Universitylocation not on record | 8 |
| TAIElocation not on record | 8 |
| Xinxiang, CN | 8 |
| FJFClocation not on record | 7 |
| KOMlocation not on record | 7 |
| Zhejiang Universitylocation not on record | 6 |
| Osaka, JP | 6 |
| Kew, GB | 6 |
| Kyoto Universitylocation not on record | 6 |
| KIRMlocation not on record | 5 |
| Nishihara, JP | 5 |
| Elocation not on record | 4 |
| Paris, FR | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| Jishou Universitylocation not on record | 4 |
| Zhejiang Museum of Natural Historylocation not on record | 4 |
| Shanghai, CN | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| 黔东南州民族医药研究所标本室location not on record | 3 |
| Awka, NG | 3 |
| Korea National Arboretumlocation not on record | 3 |
| KNAMlocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Guiyang, CN | 2 |
| LDlocation not on record | 2 |
| Burlington, US | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| FFPRIlocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Córdoba, AR | 1 |
| Edinburgh, GB | 1 |
| Mie Prefectural Museumlocation not on record | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| DNSMlocation not on record | 1 |
| Stockholm, SE | 1 |
| Xiamen, CN | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Berlin, DE | 1 |
| SMMUlocation not on record | 1 |
| Chongqing, CN | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Nanjing, CN | 1 |
| FJIDClocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Plocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Xian, CN | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Auckland, NZ | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
115 institutions · 2 091 of 2 093 vouchered records shown · 2 without an institution code
09Environmental DNA6 detections
Where the DNA of Solanum lyratum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.