Solanum laciniatum

Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records8 417

Data sources14

Biological traits50

DNA specimens6

eDNA detections6

Sources14 archives

Databases and archives Solanum laciniatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 417 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources50 traits

Chemical compositionLOTUS · NPASS18 compounds

Occurrence & distributionGBIF8 417 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex1.8 Gbp

01Narrative

Solanum laciniatum est une plante ligneuse de la famille des Solanaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology22

Fruit length25 mm

Fruit width17.5 mm

⚠ sources differ — AusTraits: 17.5 mm · GIFT: 22 mm

Leaf length150 mm

Leaf length max300 mm

Leaf size2 042 mm²

Leaf width40 mm

⚠ sources differ — AusTraits: 40 mm · GIFT: 50 mm

Leaf width max50 mm

Leaf width min50 mm

Petiole length1 cm

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · AusTraits: 3 m · TRY: 1.27 m

Plant height max4 m

Plant height min1 m

Seed length2.15 mm

⚠ sources differ — AusTraits: 2.15 mm · GIFT: 2 mm

Seed length max2 mm

Seed length min2 mm

Seed mass2.06 mg

⚠ sources differ — TRY: 2.06 mg · AusTraits: 2.11 mg · GIFT: 1.6 mg

Seed mass max2.79 mg

Seed mass min1 mg

Seed volume2 mm³

Seed volume max2 mm³

Seed volume min2 mm³

Seed width1.5 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Reproductive maturity2 years

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapelanceolate widely_ovate

Mycorrhizaabsent

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition18 compounds

Compounds documented for Solanum laciniatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Steroidal alkaloids9

Kavalactones and derivatives5

Spirostane steroids2

Documented compounds18 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4S,5'R,6R,7S,8S,9S,12S,13R,16R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-ol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-4-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-piperidine]-16-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
3-(1-Acetyl-1,5,6-trihydroxyinden-2-yl)-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
3-(5',6'-Dihydroxy-5-methyl-3-oxospiro[uran-2,1'-indene]-2'-yl)-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
3-[(2R)-5-[(E)-2-(3,4-dihydroxyphenyl)ethenyl]-5',6'-dihydroxy-3-oxospiro[furan-2,1'-indene]-2'-yl]-8,9-dihydroxypyrano[4,3-c]isochromene-1,6-dione	present	NPASS
Diosgenin	present	LOTUS
DMDPGBWTAWPKOU-SNAWJCMRSA-N	present	NPASS
Inonoblin C	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum laciniatum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences9

eDNA detections6

The DNA barcodea real sequence read deposited for this species

ITSGQ434663.1 ↗212 bp

ACGT

CGCATCGCGTCGCCCCCCGCACGCCGCCAGGCGTCGTGGGGGCGGAAGCTGGCCTCCCGTGGGCCTCGAGCTCGCGGCTGGCCTAAATGC …

Solanum laciniatum voucher PS1136MT01 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum laciniatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 760 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Solanum laciniatum1.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 92 n = 46

Ploidy4× tetraploid · measured

Chromosome records92–962n range92median92mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 927×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · book-ipcn67-71 +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · book-ipcn67-71 — GERASIMENKO, I.I., & S.A. REZNIKOVA. 1968. A cytological investigation of the genus Solanum L. (In Russian) Bot. Zurn. 53: 505-513.

CCDB · book-atlas-flowering-plants

CCDB · kew — Bennett MD, Smith JB. 1991. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 334: 309-345.

CCDB · Cave1962 — Stary & Stor. -Bur. 1962

2n 963×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.

TreeOfSex · plant — Goldblatt1979 ↗

n 464×CCDB · solan · CCDB · Cave1963 · TreeOfSex · plant

CCDB · solan

CCDB · Cave1963 — Baylis 1963

TreeOfSex · plant — randell1976|symon1994 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 417 records

Wild obs. + sensor7 639

Museum / vouchered764

Cultivated / captive5

Other9

Origin

Native235

Introduced101

Range

Area of Occupancy AOO14 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 4 269≤1 km 1 350≤10 km 562>10 km 94

6 275 georeferenced · 1 364 without coordinates

Open the mapobservation + sensor7 639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 88≤1 km 171≤10 km 246>10 km 31

536 georeferenced · 228 without coordinates

Open the institutions mapphysical evidence764

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 3 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions28 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	219
Museo Entomologico de Leonlocation not on record	106
Christchurch, NZ	101
Hobart, AU	68
Canberra, AU	37
Auckland, NZ	31
Wellington, NZ	28
SLU Artdatabankenlocation not on record	26
Kensington, AU	17
LDlocation not on record	15
Bronx, US	10
South Kensington, GB	10
Mount Annan, AU	9
Kew, GB	5
Brisbane, AU	5
La Trobe Universitylocation not on record	4
Armidale, AU	4
Rotorua, NZ	4
BIO-UNIPIlocation not on record	3
Karlsruhe, DE	3
CICYTEXlocation not on record	3
MAlocation not on record	3
Palmerston, AU	3
QVMAGlocation not on record	3
DBF-NHMDlocation not on record	3
Mlocation not on record	2
Honolulu, US	2
BDBClocation not on record	2
Olocation not on record	2
BClocation not on record	2
CJBGlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Claremont, US	2
San Diego, US	2
Tampa, US	1
John T. Waterhouse Herbariumlocation not on record	1
Moscow State Universitylocation not on record	1
Universidad de La Salle (La Salle)location not on record	1
Chongqing Museumlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Davis, US	1
Riverside, US	1
Barcelona, ES	1
Pullman, US	1
Santa Cruz, US	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Provo, US	1
Oskarshamn, SE	1
Salzburg, AT	1
KMNlocation not on record	1

50 institutions · 754 of 764 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Solanum laciniatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Solanum laciniatum

At a glance

Sources14 archives

Size & morphology22

Life cycle & reproduction12

Diet & foraging1

Habitat & environment12

Physiology & chemistry2

Other traits1

Compound class profile3 classes

Documented compounds18 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type8 417 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions28 of 50 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type8 417 records