Solanum evolvuloides

Giacomin & Stehmann · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records18

Data sources6

Biological traits8

DNA specimens2

eDNA detections2

Sources6 archives

Databases and archives Solanum evolvuloides's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Solanum evolvuloides là một loài thực vật có hoa thuộc chi Cà, được mô tả lần đầu tiên vào năm 2011 bởi Giacomin & Stehmann. Loài này chỉ biết đến ở đông nam bang Bahia, Brazil và được Liên minh Bảo tồn Thiên nhiên Quốc tế (IUCN) coi là một loài đang bị đe dọa. Tuy nhiên, lại không có bất kỳ mẫu vật nào của S. evolvuloides được lưu giữ tại các đơn vị bảo tồn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTCaatinga (stricto sensu)

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum evolvuloides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN542587.1 ↗644 bpBrazil

ACGT

GGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACACGTTCAAAAACCGGAGGCGCGCGCGGAGGGGTGGGTGGGCGTGCTTCG …

Solanum sp. StS-2011 voucher Giacomin 974 (BHCB) internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

08Occurrence & distribution

Record type18 records

Museum / vouchered18

Origin

Native2

Range

Area of Occupancy AOO28 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	6
San Jose State University, Museum of Birds and Mammalslocation not on record	2
UFMGlocation not on record	2
BMlocation not on record	1
Chicago, US	1
Jardim Botânico do Rio de Janeirolocation not on record	1
Universidade Federal de Minas Geraislocation not on record	1
JBRJlocation not on record	1
South Kensington, GB	1

9 institutions · 16 of 18 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Solanum evolvuloides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)