Solanum dimidiatum

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records8 122

Data sources12

Biological traits20

DNA specimens7

eDNA detections7

Sources12 archives

Databases and archives Solanum dimidiatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 122 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF8 122 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 72

01Narrative

Solanum dimidiatum est une espèce de plantes herbacées du genre Solanum de la famille de Solanaceae, originaire du centre des États-Unis. Cette plante est l'un des hôtes secondaires du doryphore de la pomme de terre.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length17.5 mm

Fruit width17.5 mm

Leaf length85 mm

Leaf width50 mm

Petiole length2.5 cm

Plant height0.5 m

Seed length3.25 mm

Seed mass8.41 mg

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

Leaf shapenarrowly_ovate ovate

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Solanum dimidiatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Steroidal alkaloids2

Documented compounds2 total

Compound	Class	Amount	Source
Solasonine		present	LOTUS
Tomatine solaradixine		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum dimidiatum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences6

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC539147.1 ↗631 bpUSA

ACGT

TTGTCGAAGCCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACTGGGGGAGCCGCGCGGCGGGGGCGCTACGGCGTCGCCCCGCGC …

Solanum dimidiatum isolate LB1954 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS6ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Solanum dimidiatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records24–722n range72median72mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 723×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl — Nichols, R. L. & W. W. Hanna. 1984. Irregular meiosis in Solanum dimidiatum. Solanaceae Newslett. 2: 15.

TreeOfSex · plant — Goldblatt1979 ↗

2n 241×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — La Cour 1952

2n 361×CCDB · book-ipcn72

CCDB · book-ipcn72 — HARDIN, J.W., G. DOERKSEN, D. HERNDON, M. HOBSON, & F. THOMAS. 1972. Pollination ecology and floral biology of four weedy genera in southern Oklahoma. Southw. Naturalist 16: 403-412.

n 123×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — Goldblatt1979|darcy1974|jepson1993|lemke1991 ↗

n 362×CCDB · solan · CCDB · ipcn-api-dl

CCDB · solan

CCDB · ipcn-api-dl

n 181×CCDB · book-ipcn72

CCDB · book-ipcn72 — HARDIN, J.W., G. DOERKSEN, D. HERNDON, M. HOBSON, & F. THOMAS. 1972. Pollination ecology and floral biology of four weedy genera in southern Oklahoma. Southw. Naturalist 16: 403-412.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 122 records

Wild obs. + sensor7 607

Museum / vouchered508

Other7

Origin

Introduced1

Range

Area of Occupancy AOO11 992 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4 542≤1 km 780≤10 km 224>10 km 497

6 043 georeferenced · 1 564 without coordinates

Open the mapobservation + sensor7 607

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 25≤1 km 83≤10 km 126>10 km 38

272 georeferenced · 236 without coordinates

Open the institutions mapphysical evidence508

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions35 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Fort Worth, US	106
Austin, US	63
Bronx, US	61
Wuzhou, CN	35
Texas Lutheran Universitylocation not on record	29
BAYLUlocation not on record	23
Jena Microbial Resource Collectionlocation not on record	21
Canadian Department of Agriculturelocation not on record	14
Chicago, US	12
Denton, US	11
Saint Louis, US	11
San Angelo, US	11
Stephenville, US	8
Pittsburg, US	7
Brisbane, AU	7
Valdosta State Universitylocation not on record	6
South Kensington, GB	6
GAlocation not on record	6
Miami, US	5
Riverside, US	5
Lubbock, US	4
EL PASO, US	4
Bloomington, US	4
Jackson, US	3
Albuquerque, US	3
Tampa, US	3
Fayetteville, US	3
Davis, US	3
Tall Timbers Research Stationlocation not on record	2
Tuscaloosa, US	2
Provo, US	2
Flagstaff, US	2
Kew, GB	2
Chongqing Museumlocation not on record	2
Columbia, US	2
Durango, MX	1
Paris, FR	1
Museo Entomologico de Leonlocation not on record	1
Clemson, US	1
Little Rock, US	1
University of Stellenboschlocation not on record	1
Edmonton, CA	1
Adelaide, AU	1
Claremont, US	1
St. Augustine, TT	1
CJBGlocation not on record	1

46 institutions · 499 of 508 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Solanum dimidiatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources12 archives

Size & morphology8

Life cycle & reproduction2

Diet & foraging1

Habitat & environment9

Compound class profile1 class

Documented compounds2 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 122 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions35 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type8 122 records