Solanum commersonii

Dunal ex Poir. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records865

Data sources12

Biological traits11

DNA specimens3

eDNA detections1

Sources12 archives

Databases and archives Solanum commersonii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility865 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF865 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex790 Mbp

01Narrative

Solanum commersonii est une espèce de plante herbacée tubéreuse de la famille des Solanaceae. Cette espèce, vivace par ses tubercules, est originaire d'Amérique du Sud. Elle est apparentée à la pomme de terre cultivée mais contrairement à celle-ci est diploïde. Solanum commersonii a été utilisée dans des programmes d'amélioration génétique de la pomme de terre, au prix de manipulation des niveaux de ploïdie. Elle présente divers caractères intéressants, tels la résistance à des maladies et à des ravageurs, une certaine tolérance au gel, et un taux élevé de matière sèche dans les tubercules. Ses organes végétatifs contiennent divers glycoalcaloïdes, notamment la commersonine, la démissine, la tomatine et la déhydrocommersonine

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max400 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTÁrea Antrópica, Campo Limpo

Woodinessnon-woody

03Chemical composition9 compounds

Compounds documented for Solanum commersonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Steroidal alkaloids9

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[(2R,3R,4S,5R,6R)-2-[(2R,3R,4R,5R,6S)-4,5-dihydroxy-2-(hydroxymethyl)-6-[[(1S,2R,5S,7S,10R,11S,14R,15S,16R,17S,20S,23R)-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracosan-7-yl]peroxy]oxan-3-yl]oxy-5-hydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-4-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5S,6R)-5-hydroxy-6-(hydroxymethyl)-2-[[(1S,2S,7S,10R,11S,14S,15R,16S,17R,20S,23R)-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracos-4-en-7-yl]oxy]-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[(2S,3R,4S,5R,6R)-2-[(2R,3R,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[[(1S,2R,5S,7S,10S,11S,14S,15R,16S,17S,20S,23S)-10,14,16,20-tetramethyl-22-azahexacyclo[12.10.0.02,11.05,10.015,23.017,22]tetracosan-7-yl]oxy]oxan-3-yl]oxy-5-hydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(3beta,22beta,25S)-Spirosol-5-en-3-yl O-6-deoxy-alpha-L-mannopyranosyl-(1->2)-O-(6-deoxy-alpha-L-mannopyranosyl-(1->4))-beta-D-glucopyranoside	present	LOTUS
(3beta,22beta,25S)-Spirosol-5-en-3-yl O-6-deoxy-alpha-L-mannopyranosyl-(1->2)-O-(beta-D-glucopyranosyl-(1->3))-beta-D-galactopyranoside	present	LOTUS
Commersonine	present	LOTUS
Dehydrocommersonine	present	LOTUS
Tomatine	present	LOTUS
α-chaconine	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum commersonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON509786.1 ↗155 497 bp

ACGT

CTGTCTAATATCTCATATTTATGAATTATGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCAC …

Solanum commersonii voucher CIP 762476 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL10★ITS

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI

The complete instruction manual Solanum commersonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size790 383 673 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Solanum commersonii0.79 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–362n range24median24mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 246×GoaT · Tree of Sex Database · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +2

GoaT · Tree of Sex Database — ↗

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Masuelli, R. W. & E. L. Camadro. 1992. Cytological analysis and fertility of Solanum commersonii Dun. x Solanum gourlayi Haw. triploid hybrids. Cytologia 57: 161–166.

CCDB · book-atlas-flowering-plants — Koopmans 1951

CCDB · Cave1956 — Lhoas

TreeOfSex · plant — Goldblatt1979 ↗

2n 361×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Rybin 1933

n 128×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — correll1962|hawkes1969|hawkes1990|hijmans2007 ↗

n 182×CCDB · solan

CCDB · solan

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness97.9% BUSCO

08Occurrence & distribution

Record type865 records

Wild obs. + sensor173

Museum / vouchered200

Cultivated / captive4

Other488

Origin

Native189

Range

Area of Occupancy AOO2 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 80≤1 km 33≤10 km 14>10 km 6

133 georeferenced · 40 without coordinates

Open the mapobservation + sensor173

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 199 without coordinates

Open the institutions mapphysical evidence200

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pelotas, BR	152
Blumenau, BR	9
Córdoba, AR	6
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Lake Charles, US	4
JBRJlocation not on record	3
UNESClocation not on record	2
Criciúma, BR	2
FUVATESlocation not on record	2
Xiamen, CN	1
Kew, GB	1
Universidade Federal de Santa Catarinalocation not on record	1
Foz do Iguaçu, BR	1
UFPRlocation not on record	1
Chongqing Museumlocation not on record	1
Saint Louis, US	1
St. Paul, US	1
Cenargenlocation not on record	1
University of Stellenboschlocation not on record	1
Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record	1
UFSClocation not on record	1
UTFPR-CPlocation not on record	1

22 institutions · 198 of 200 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Solanum commersonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)