Solanum cinereum

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records3 380

Data sources9

Biological traits35

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Solanum cinereum's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 380 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources35 traits

Occurrence & distributionGBIF3 380 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · TreeOfSex2n = 24

02Traits & measurements

SourcesAusTraitsTRYGIFT

Size & morphology16

Fruit length17.5 mm

Fruit width17.5 mm

Leaf length80 mm

Leaf length max124 mm

Leaf length min53 mm

Leaf width47.5 mm

Leaf width max60 mm

Leaf width min35 mm

Petiole length1.5 cm

Plant height1 m

Plant height max1 m

Seed length3 mm

Seed mass3.01 mg

⚠ sources differ — TRY: 3.01 mg · AusTraits: 1.8 mg · GIFT: 3.32 mg

Seed mass max4.89 mg

Seed mass min1.76 mg

Seed width2.77 mm

Life cycle & reproduction6

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyyyynnnyyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityfire_killed

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum cinereum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY996493.1 ↗603 bp

ACGT

GGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGAGGGGGCCGCGCCCCGCGCGCGTCCCCCTCTCGCC …

Solanum cinereum voucher Bohs 2852 UT 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Solanum cinereum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — NA

n 124×CCDB · solan · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · solan

CCDB · book-ipcn75-78 — NA

TreeOfSex · plant — randell1976|solsource ↗

n 241×CCDB · solan

CCDB · solan

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 380 records

Wild obs. + sensor2 792

Museum / vouchered568

Cultivated / captive14

Other6

Origin

Native187

Introduced12

Range

Area of Occupancy AOO6 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 279≤1 km 129≤10 km 51>10 km 15

2 474 georeferenced · 318 without coordinates

Open the mapobservation + sensor2 792

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 129≤1 km 68≤10 km 244>10 km 44

485 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence568

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy90% within 1 km

≤100 m 9≤10 km 1

10 georeferenced · 4 without coordinates

Open the mapnot free-living14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	181
Adelaide, AU	110
Canberra, AU	80
Brisbane, AU	55
NSW Dept of Planning, Industry and Environmentlocation not on record	46
Armidale, AU	41
Museo Entomologico de Leonlocation not on record	30
Bronx, US	6
Kew, GB	5
NSW Office of Environment and Heritagelocation not on record	4
Parkville, AU	2
Stockholm, SE	1
John T. Waterhouse Herbariumlocation not on record	1
Córdoba, AR	1
Palmerston, AU	1
Batemans Bay, AU	1

16 institutions · 565 of 568 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Solanum cinereum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Solanum cinereum

At a glance

Sources9 archives

Size & morphology16

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 380 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 380 records