Solanum chilense

(Dunal) Reiche · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records502

Data sources14

Biological traits15

DNA specimens2

eDNA detections2

Sources14 archives

Databases and archives Solanum chilense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility502 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources15 traits

Chemical compositionNPASS14 compounds

Occurrence & distributionGBIF502 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · TreeOfSex · GoaT≈962 Mbp

01Narrative

Solanum chilense est une espèce de plante de la famille des Solanaceae, originaire du Nord-Ouest de l'Amérique du Sud. C'est une sorte de tomate sauvage à petits fruits blanc verdâtre rayés de pourpre à maturité.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass1.24 mg

Seed mass max1.3 mg

Seed mass min1.3 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herbaceous perennial

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)151 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)36.8 mm²/mg

03Chemical composition14 compounds

Compounds documented for Solanum chilense across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Ursane and Taraxastane triterpenoids3

Furofuranoid lignans3

Lupane triterpenoids2

Flavones2

Cinnamic acids and derivatives1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(4R,4aR,6S,7S,7aS)-6-hydroxy-7-(hydroxymethyl)-4-methyl-4,4a,5,6,7,7a-hexahydro-3H-cyclopenta[c]pyran-1-one	present	NPASS
1H,3H-Furo[3,4-c]furan-3a(4H)-ol, dihydro-1,4-bis(4-hydroxy-3-methoxyphenyl)-, (1R,3aS,4S,6aR)-	present	NPASS
23-Hydroxyursolic Acid	present	NPASS
24-Hydroxyursolic Acid	present	NPASS
3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid	present	NPASS
8-Hydroxypinoresinol	present	NPASS
Betulin	present	NPASS
Betulinic Acid	present	NPASS
Diosmetin	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum chilense has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ300203.1 ↗622 bpChile

ACGT

GTCGAAACTGGACCGCAGAACGACTCGCGAATCGTTTTAAACACTGGGGGCGGAGCTCGCTCGTCGCGCGCCTCCCTCCCGTCGCCCGCT …

Lycopersicon chilense 5.8S rRNA gene, internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · TreeOfSex · GoaT · NCBI

The complete instruction manual Solanum chilense carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈962 238 642 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Solanum chilense0.96 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · iapt

CCDB · ipcn-api-dl — Cawood, A.H. & J. K. Jones. 1980. Chromosome behaviour during meiotic prophase in the Solanaceae. Chromosoma 80: 57–68.

CCDB · iapt — IAPT/IOPB Chromosome Data 25

n 124×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — peralta2008|solsource ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type502 records

Wild obs. + sensor152

Museum / vouchered132

Cultivated / captive60

Other158

Origin

Native159

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 59≤1 km 34≤10 km 16>10 km 6

115 georeferenced · 37 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 132 records without

Open the institutions mapphysical evidence132

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 24>10 km 9

33 georeferenced · 27 without coordinates

Open the mapnot free-living60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	25
Davis, US	18
Bronx, US	12
Valparaiso, CL	12
San Isidro, AR	11
University of Stellenboschlocation not on record	8
Edinburgh, GB	6
South Kensington, GB	6
Kew, GB	5
Viña del Mar, CL	5
Chicago, US	4
Riverside, US	4
MAlocation not on record	3
CASlocation not on record	2
MeiseBGlocation not on record	2
Córdoba, AR	2
Cusco, PE	1
Tampa, US	1
Berlin, DE	1
UNESP-FCAlocation not on record	1

20 institutions · 129 of 132 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Solanum chilense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 14.1–14.1

Seasonal swing summer↔winter12.4 °C

Max temp (day)20.5 °C

Min temp (night)8.70 °C

Precipitation145 mm/mo

Air humidity58.8 %

Moisture balance39.0 mm/mo

Vapour deficit702 Pa

Wind speed2.50 m/s

Cloud cover20.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)