Solanum campylacanthum

Hochst. ex A.Rich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records6 411

Data sources11

Biological traits10

DNA specimens77

eDNA detections40

Sources11 archives

Databases and archives Solanum campylacanthum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 411 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF6 411 records

Environmental DNA1 datasets · 4 countries40 detections

DNA & barcodingBOLD · NCBI77 specimens

Genome at a glanceCCDB · TreeOfSex2n = 24

01Narrative

الباذنجان الأفريقي هو نوع من النباتات العشبية التي تنتمي لعائلة الباذنجانيات، وتنتشر زراعته في شرق ووسط وجنوب إفريقيا حيث ينمو في المراعي والسافانا والغابات مثل غابات المرتفعات الكينية. ثمار نبات الباذنجان الأفريقي سامة، وعلى الرغم من ذلك، فإنها تُستخدم للعديد من الأغراض الطبية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.86 mg

⚠ sources differ — TRY: 3.86 mg · GIFT: 4.55 mg

Seed mass max6.06 mg

Seed mass min3.53 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Habitat & environment4

Climateseasonally dry tropical

Climberself-supporting

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum campylacanthum has left across the world's sequence archives.

At a glance

DNA specimens77

Marker genes7

GenBank sequences10

eDNA detections40

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMK261282.1 ↗271 bpKenya · 2013

ACGT

TTTTCATAGGTGAACCTGCGGAAGGATCATTGTTAAAACCTGCACAGCAGAACGACCCGCGAACACGTTCAAACACCGAGGGAGCCACGT …

Solanum campylacanthum voucher C11_K1246_Solanum_incanum small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · TreeOfSex

The complete instruction manual Solanum campylacanthum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–482n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · Cave1958 · CCDB · Cave1959

CCDB · Cave1958 — U. Wisconsin 1958

CCDB · Cave1959 — Ochoa 1958

2n 481×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 25

n 123×CCDB · solan · TreeOfSex · plant

CCDB · solan

TreeOfSex · plant — schmelzer2008 ↗

n 242×CCDB · solan

CCDB · solan

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 411 records

Wild obs. + sensor4 713

Museum / vouchered798

Other900

Origin

Native70

Introduced2 731

Range

Area of Occupancy AOO18 300 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 1 158≤1 km 223≤10 km 2 825>10 km 46

4 252 georeferenced · 461 without coordinates

Open the mapobservation + sensor4 713

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤1 km 7≤10 km 5

12 georeferenced · 786 without coordinates

Open the institutions mapphysical evidence798

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	222
Kew, GB	134
South Kensington, GB	107
Saint Louis, US	78
MeiseBGlocation not on record	65
South African National Biodiversity Institute, The National Herbariumlocation not on record	24
Durban, ZA	22
Bronx, US	15
Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record	8
Instituto de Investigação Científica Tropicallocation not on record	8
Stockholm, SE	7
Paris, FR	7
TAFORI-LSRClocation not on record	4
Frankfurt am Main	2
Arusha, TZ	2
EAlocation not on record	2
DSMlocation not on record	1
MAlocation not on record	1
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	1
CJBGlocation not on record	1
Wlocation not on record	1
National Museums of Kenyalocation not on record	1
Uppsala, SE	1

23 institutions · 714 of 798 vouchered records shown · 82 without an institution code

09Environmental DNA40 detections

Where the DNA of Solanum campylacanthum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map4 countries0

Savanna grasslandUHURU North Plots; Savanna bushland in red s…Floodplain/ThicketUHURU South Plots; Savanna bushland in red s…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 7.80–24.2

Seasonal swing summer↔winter9.10 °C

Max temp (day)23.9 °C 14.4–29.1

Min temp (night)13.5 °C 2.10–19.2

Precipitation48.8 mm/mo 15.9–111

Air humidity56.5 % 50.6–61.6

Moisture balance-61.4 mm/mo -112–-20.6

Vapour deficit864 Pa 514–1,262

Wind speed2.70 m/s 2.10–3.50

Cloud cover23.7 % 7.60–34.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Solanum campylacanthum

At a glance

Sources11 archives

Size & morphology3

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 411 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 411 records