Solanum baretiae — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Solanum

At a glance

Occurrence records8

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Solanum baretiae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 records

DNA & barcodingNCBIsequences

01Narrative

Solanum baretiae est une espèce de plantes herbacées de la famille des Solanaceae découverte en 1992. Elle a été nommée ainsi en 2012 par E.J. Tepe en l'honneur de Jeanne Barret, exploratrice et botaniste française. Compagne du botaniste Philibert Commerson, elle a secondé ce dernier lors de la première expédition de Bougainville autour du monde.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Solanum baretiae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKR872955.1 ↗601 bp

ACGT

GGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACACGTTTCAACACTTGGGGGCGACGCGCGCTCGGGGGTGCTTAGGCCTCC …

Solanum baretiae isolate LB3005 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type8 records

Museum / vouchered8

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 4

4 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence8

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	6
Edinburgh, GB	1
Saint Louis, US	1

3 institutions · 8 of 8 vouchered records shown