Smithia conferta

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Smithia

At a glance

Occurrence records166

Data sources9

Biological traits27

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Smithia conferta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF166 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 38

01Narrative

密节坡油甘（学名：）为豆科坡油甘属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length5 mm

Leaf length11.5 mm

Leaf width2.5 mm

Plant height1 m

Plant height max0.5 m

Plant height min0 m

Seed length1 mm

Seed mass0.31 mg

Seed width1 mm

Life cycle & reproduction7

Flowering timennyyyynnnnnn

Life formannual

Life spanannual perennial

⚠ sources differ — AusTraits: annual perennial · GIFT: annual

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: shrub

Leaf compoundnesscompound

Leaf shapeoblong

Woodinesswoody

⚠ sources differ — AusTraits: woody · GIFT: non-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smithia conferta has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN174058.1 ↗626 bp

ACGT

CATTTTTGTTGCCTCGACCGAGCTAAACCCGTGCATTGGTTACAATTCCCGGGGAGGTCGTAGTTGCCATTGCAGCTCGAGCACTCCACG …

Smithia conferta strain genomic DNA containing ITS1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Smithia conferta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–382n range38median38mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 386×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +1

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-indian_vol1 — Bir, S.S. & Kumari, S. 1973

CCDB · eflora

n 192×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type166 records

Wild obs. + sensor19

Museum / vouchered146

Other1

Origin

Native8

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 7≤1 km 2≤10 km 2

11 georeferenced · 8 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 32≤1 km 3≤10 km 50>10 km 10

95 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence146

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	34
Palmerston, AU	20
Museo Entomologico de Leonlocation not on record	11
Canberra, AU	9
Baroda, IN	7
Smithfield, AU	7
Beijing, CN	5
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	5
Mount Annan, AU	4
Guangzhou, CN	3
Guilin, CN	2
Guangzhou, CN	2
Kew, GB	2
Fujian Institute of Subtropical Botanylocation not on record	2
Adelaide, AU	2
Nagasaki University - Fisherieslocation not on record	2
Xiamen, CN	1
NGCPR01340location not on record	1
Kensington, AU	1
NGCPR01767location not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1

21 institutions · 122 of 146 vouchered records shown · 24 without an institution code

09Environmental DNA2 detections

Where the DNA of Smithia conferta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)