Smilax zeylanica

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records115

Data sources10

Biological traits24

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Smilax zeylanica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources24 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF115 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Smilax zeylanica là một loài thực vật có hoa trong họ Smilacaceae. Loài này được L. miêu tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Leaf size12 250 mm²

Plant height0.603 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Growth formother

⚠ sources differ — GIFT: other · TRY: Climber

Leaf formoval

Woodinesswoody

Physiology & chemistry6

Leaf c526 mg/g

Leaf dry-matter content (LDMC)249 mg/g

Leaf n17.83 mg/g

Leaf p3.12 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)23.53 mm²/mg

Other traits4

Defenseyes

Leaf marginentire

Leaf spinesyes

Leaf thornsno

03Chemical composition1 compounds

Compounds documented for Smilax zeylanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Spirostane steroids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Yamogenin		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax zeylanica has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJF978786.1 ↗653 bpIndonesia · 2009

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGACGCGGCCGCCACGCGCGGC …

Smilax zeylanica voucher FCX-S05081413 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Smilax zeylanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–322n range32median32mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1987. Cytology of five species of Smilax from south India. Nucleus (Calcutta) 30: 57–60.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1989. Karyomorphology of five south Indian species of Smilax Linn. Cytologia 54: 65–72.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

n 162×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1987. Cytology of five species of Smilax from south India. Nucleus (Calcutta) 30: 57–60.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type115 records

Wild obs. + sensor24

Museum / vouchered91

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 4≤10 km 4

8 georeferenced · 16 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 3≤10 km 3

6 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	12
Baroda, IN	5
Kew, GB	5
South Kensington, GB	5
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Beijing, CN	2
Honolulu, US	2
Bronx, US	1
BMlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Uppsala, SE	1
McWane Science Centerlocation not on record	1
NGCPR01335location not on record	1
Dehra Dun, IN	1

14 institutions · 41 of 91 vouchered records shown · 50 without an institution code

09Environmental DNA2 detections

Where the DNA of Smilax zeylanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.7 °C 28.7–28.7

Seasonal swing summer↔winter11.9 °C

Max temp (day)31.9 °C

Min temp (night)24.8 °C

Precipitation187 mm/mo

Air humidity62.4 %

Moisture balance33.3 mm/mo

Vapour deficit1,478 Pa

Wind speed2.80 m/s

Cloud cover9.20 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)