Smilax pseudochina

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records114

Data sources10

Biological traits10

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Smilax pseudochina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF114 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Smilax pseudochina là một loài thực vật có hoa trong họ Smilacaceae. Loài này được L. miêu tả khoa học đầu tiên năm 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formclimbing perennial

Life spanannual

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberobligatory

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Vine, Forb/herb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax pseudochina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJF461365.1 ↗824 bp

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCCTCCGGCCCGCCGCCCCTCGGGGCGCGCCCGCGCGGCGCGT …

Smilax pseudochina voucher KF 03016 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Smilax pseudochina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome records30–302n range30median30mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 302×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — MANGALY, J.K. 1968. A cytotaxonomic study of the herbaceous species of Smilax: Section Coprosmanthus. Rhodora 70: 55-82.

CCDB · eflora

n 151×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — MANGALY, J.K. 1968. A cytotaxonomic study of the herbaceous species of Smilax: Section Coprosmanthus. Rhodora 70: 55-82.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type114 records

Wild obs. + sensor70

Museum / vouchered44

Origin

Native1

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 24≤1 km 3≤10 km 2>10 km 41

70 georeferenced

Open the mapobservation + sensor70

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 2≤1 km 1≤10 km 10>10 km 3

16 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Stellenboschlocation not on record	27
Washington, US	2
Wuzhou, CN	2
Chongqing Museumlocation not on record	2
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Maryland Department of Natural Resourceslocation not on record	1
Columbia, US	1
Chapel Hill, US	1
Canadian Department of Agriculturelocation not on record	1
Bangkok, TH	1
Williamsburg, US	1
Staten Island, US	1

12 institutions · 41 of 44 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Smilax pseudochina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)