Smilax officinalis

Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records252

Data sources8

Biological traits13

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Smilax officinalis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF252 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Smilax officinalis là một loài thực vật có hoa trong họ Smilacaceae. Loài này được Kunth miêu tả khoa học đầu tiên năm 1816.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height25 m

Life cycle & reproduction2

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formclimber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition5 compounds

Compounds documented for Smilax officinalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Spirostane steroids3

Furostane steroids2

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18R)-16-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18S)-16-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-[[(2R,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-6-[(1R,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S,18S,19R)-19-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxy-2-[[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-6-[(1R,2S,4S,5'S,6R,7S,8R,9S,12S,13S,16S,18R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxy-2-[[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
I(2)-D-Glucopyranoside, (3I(2),5I+/-,25S)-spirostan-3-yl O-I+/--L-arabinopyranosyl-(1a6)-O-[I(2)-D-glucopyranosyl-(1a4)]-	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax officinalis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJF461371.1 ↗815 bp

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGAGGGCGGGCACGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGACGCGGCCGCCCCGCGCGGC …

Smilax officinalis voucher J. Masis 37 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type252 records

Wild obs. + sensor14

Museum / vouchered238

Range

Area of Occupancy AOO636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤10 km 2>10 km 2

5 georeferenced · 233 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	166
San José, CR	19
León, NI	13
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	7
Chicago, US	6
UFPElocation not on record	2
Universidad de Antioquia (UdeA)location not on record	2
Durham, US	2
Provincial Museum of Albertalocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Guatemala City, GT	1
Universiti Sains Malaysialocation not on record	1
BMlocation not on record	1
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	1
FLASlocation not on record	1
QCNElocation not on record	1
Universidad de Guayaquillocation not on record	1
Fort Worth, US	1
CUVClocation not on record	1
arosemena tola, EC	1
Chongqing Museumlocation not on record	1
Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record	1
PUC-RSlocation not on record	1
South Kensington, GB	1

24 institutions · 234 of 238 vouchered records shown · 4 without an institution code

09Environmental DNA2 detections

Where the DNA of Smilax officinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)