Smilax melastomifolia

Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records470

Data sources6

Biological traits14

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Smilax melastomifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF470 records

DNA & barcodingNCBIsequences

01Narrative

Smilax melastomifolia, the Hawai'i greenbrier, is a species of spiny vine found in nature only in the Hawaiian Islands.Wagner, W.L., Herbst, D.R. & Sohmer, S.H. (1999). Manual of the Flowering Plants of Hawai'i. Revised Edition, Volume 2. Special Publications; Bernice Pauahi Bishop Museum 97: 989-1919. Spines occur not only on the stems but also on the underside of the leaves and on the peduncles of female flowers. Berries are white or pale green.Seemann, Berthold Carl 1868. Journal of Botany, British and Foreign 6: 194 as Pleiosmilax menziesiiDr. Gerald (Gerry) Carr Emeritus Professor of Botany, Oregon State UniversityFlowering Plants of Hawaii

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Vine, Shrub

Woodinesswoody

Physiology & chemistry5

Leaf C:N ratio43.51 g/g

Leaf c496 mg/g

Leaf n11.4 mg/g

Leaf p0.51 mg/g

Specific leaf area (SLA)6.07 mm²/mg

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax melastomifolia has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF978740.1 ↗813 bpUSA · 2000

ACGT

CCGCGAACTCGGAACGGACGCTGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGGCGCGGCCGCCCCGCGCGGC …

Smilax melastomifolia voucher FCX-TM1986 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type470 records

Wild obs. + sensor410

Museum / vouchered60

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 150≤1 km 33≤10 km 17>10 km 138

338 georeferenced · 72 without coordinates

Open the mapobservation + sensor410

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤1 km 11≤10 km 6

17 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence60

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	33
Honolulu, US	16
Vancouver, CA	5
University of Stellenboschlocation not on record	2
Bronx, US	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Auckland, NZ	1
ASUlocation not on record	1

8 institutions · 60 of 60 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)