Smilax canariensis

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records192

Data sources6

Biological traits27

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Smilax canariensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility192 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Occurrence & distributionGBIF192 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Smilax canariensis Willd. é uma espécie botânica de trepadeira pertencente à família das Smilacaceae, endemismo da Macaronésia e presente nas Ilhas Canárias e na Madeira. A partir desta espécie foi recentemente autonomizada a espécie Smilax azorica H. Schaef. & P. Schoenfelder.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Fruit length max6 mm

Fruit length min4 mm

Plant height20 m

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Flower colourgreen

Flowering endDec

Flowering startOct

Life formclimber

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Climatesubtropical

Climberobligatory

Elevation max1 300 m

Elevation min400 m

Epiphyteterrestrial

Fruit colourblack

Fruit typeberry

Growth formclimber

Leaf formlanceolate

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits4

Defenseyes

Inflorescencecyme

Shoot length max500 cm

Shoot orientationscandent

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax canariensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC511495.1 ↗803 bp

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCTCGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGACGCGGACGCGGCCCGGCGG …

Smilax canariensis voucher P. Schoenfelder 95-205 (REG) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type192 records

Wild obs. + sensor181

Museum / vouchered11

Range

Area of Occupancy AOO352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 54≤1 km 36≤10 km 66>10 km 7

163 georeferenced · 18 without coordinates

Open the mapobservation + sensor181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	5
Barcelona, ES	1
MAlocation not on record	1
Philadelphia, US	1
College of the Atlantic, Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

6 institutions · 10 of 11 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Smilax canariensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)