Smilax azorica

H.Schaef. & P.Schönfelder · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records1 052

Data sources8

Biological traits14

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Smilax azorica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 052 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 052 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT · NCBI≈1.7 Gbp

01Narrative

Smilax azorica is a species of flowering plants of the Smilacaceae family. The species is endemic to the Azores. It was first described in 1844 as Smilax divaricata, a name that had already been given to another species. It was renamed Smilax azorica in 2009.Schaefer H., & Schoenfelder P. (2009). "Smilax canariensis, S. azorica (Smilacaceae) and the genus Smilax in Europe." in Homenaje al Profesor Dr. Wolfredo Wildpret de la Torre. Instituto de Estudios Canarios: pp. 297-307.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max10 m

Seed mass48 mg

Life cycle & reproduction6

Dispersal typeanimal

Life formclimber

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatesubtropical

Climberobligatory

Epiphyteterrestrial

Growth formclimber

Other traits1

Seeds per fruit101-1000

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax azorica has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC511491.1 ↗785 bp

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGACGCTGCCGCGGCCCGGCGG …

Smilax azorica voucher H. Schaefer 2008/205 (BM) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Smilax azorica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 688 619 151 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Smilax azorica1.69 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 052 records

Wild obs. + sensor1 031

Museum / vouchered4

Other17

Origin

Native51

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 146≤1 km 868≤10 km 3>10 km 1

1 018 georeferenced · 13 without coordinates

Open the mapobservation + sensor1 031

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA5 detections

Where the DNA of Smilax azorica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Smilax azorica

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction6

Diet & foraging1

Habitat & environment4

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 052 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 052 records