Smilax australis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Liliales/Smilacaceae/Smilax

At a glance

Occurrence records21 414

Data sources6

Biological traits46

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Smilax australis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Occurrence & distributionGBIF21 414 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Smilax australis est une plante grimpante monocotylédone appartenant au genre Smilax, qui fait lui-même partie de l’ordre des Liliales et de la famille des Smilacacées endémique en Australie. Ses tiges épineuses font jusqu'à 8 mètres de long et portent des vrilles qui mesurent jusqu'à 20 cm de long. Les feuilles luisantes ont 5 nervures longitudinales proéminentes et font de 5 à 15 cm de long sur 3 à 10 cm de largeur.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology20

Fruit length7 mm

Fruit width7 mm

Leaf length74.5 mm

Leaf length max150 mm

Leaf length min50 mm

Leaf mass313 mg

Leaf mass per area105 g/m2

Leaf size2 287 mm²

Leaf width45 mm

Leaf width max100 mm

Leaf width min30 mm

Petiole length1.25 cm

Plant height6 m

⚠ sources differ — AusTraits: 6 m · TRY: 0.7 m

Plant height max10 m

Plant height min0 m

Seed length5 mm

Seed mass40.76 mg

⚠ sources differ — TRY: 40.76 mg · AusTraits: 35.28 mg · GIFT: 40.76 mg

Seed mass max40.76 mg

Seed mass min40.76 mg

Seed width5 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life formclimber

Life spanperennial

Lifespan years17.5 years

Pollination syndromeinsect

Reproductive maturity3 years

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: climber_herbaceous · TRY: climber

Leaf compoundnesssimple

Leaf shapelanceolate ovate widely_elliptical

Woodinessnon-woody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)12.72 mm²/mg

Wood density542 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax australis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF461350.1 ↗805 bp

ACGT

CCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGTCGCCCCTCGGGCCGCGGCCGCACGGCCCGGC …

Smilax australis voucher K. Cameron 1139 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type21 414 records

Wild obs. + sensor19 226

Museum / vouchered1 089

Cultivated / captive9

Fossil1

Other1 089

Origin

Native162

Range

Area of Occupancy AOO38 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 15 478≤1 km 1 164≤10 km 282>10 km 370

17 294 georeferenced · 1 932 without coordinates

Open the mapobservation + sensor19 226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 167≤1 km 244≤10 km 436>10 km 86

933 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence1 089

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy89% within 1 km

≤100 m 3≤1 km 5≤10 km 1

9 georeferenced

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	209
Museo Entomologico de Leonlocation not on record	180
Canberra, AU	163
Mount Annan, AU	147
Palmerston, AU	111
Smithfield, AU	68
Armidale, AU	47
Kensington, AU	35
John T. Waterhouse Herbariumlocation not on record	22
Batemans Bay, AU	18
Adelaide, AU	17
Wollongong, AU	9
NSW Dept of Planning, Industry and Environmentlocation not on record	7
Hobart, AU	6
Beijing, CN	4
Kew, GB	4
James Cook Townsvillelocation not on record	4
La Trobe Universitylocation not on record	4
Parkville, AU	3
Honolulu, US	2
Zürich, CH	2
EL PASO, US	1
Uppsala, SE	1
BGPAlocation not on record	1
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1

25 institutions · 1 066 of 1 089 vouchered records shown · 23 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Smilax australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.3 °C 18.3–18.3

Seasonal swing summer↔winter10.6 °C

Max temp (day)23.0 °C

Min temp (night)14.4 °C

Precipitation132 mm/mo

Air humidity61.0 %

Moisture balance13.6 mm/mo

Vapour deficit823 Pa

Wind speed3.10 m/s

Cloud cover25.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Smilax australis

At a glance

Sources6 archives

Size & morphology20

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

At a glance

Record type21 414 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type21 414 records