Smilax aspera
speciesAt a glance
Occurrence records95 942
Data sources14
Biological traits60
DNA specimens84
eDNA detections82
Sources14 archives
Databases and archives Smilax aspera's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility95 942 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics84 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources60 traits
Chemical compositionLOTUS · NPASS46 compounds
Occurrence & distributionGBIF95 942 records
Environmental DNA1 datasets · 4 countries82 detections
DNA & barcodingBOLD · NCBI84 specimens
Genome at a glanceCCDB · GoaT5.1 Gbp
01Narrative
La Salsepareille ou Salsepareille d'Europe est une espèce de plantes monocotylédones de la famille des Smilacacées. Elle est parfois appelée liseron épineux. On consomme les jeunes pousses et, de même que plusieurs autres plantes du genre Smilax, elle est utilisée pour ses vertus médicinales.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTWCVP
Size & morphology21
Fruit length7.3 mm
Fruit length max6 mm
Fruit length min6 mm
Fruit width7.3 mm
Fruit width max6 mm
Fruit width min6 mm
Inflorescence length max45 cm
Inflorescence length min7.0 cm
Leaf length85 mm
Leaf length max110 mm
Leaf length min60 mm
Leaf width max95 mm
Leaf width min50 mm
Plant height3 m
⚠ sources differ — GIFT: 3 m · TRY: 0.51 m
Plant height max1 m
Seed mass38.91 mg
Seed mass max81 mg
Seed mass min13.83 mg
Seed volume22 mm³
Seed volume max22 mm³
Seed volume min22 mm³
Life cycle & reproduction13
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourwhite
Flowering endDec
Flowering startAug
Life formclimber
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formphanerophyte
Self fertilizationabsent
Sex typedioecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberobligatory
Elevation max3 100 m
Elevation mean1 500 m
Elevation min1 000 m
Epiphyteterrestrial
Fruit colourblack
Fruit fleshinessfleshy
Fruit typeberry
Growth formother
⚠ sources differ — GIFT: other · TRY: Climber
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry8
Leaf C:N ratio26.05 g/g
Leaf c485 mg/g
Leaf dry-matter content (LDMC)316 mg/g
Leaf n20.5 mg/g
Leaf p0.4 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)10.15 mm²/mg
Other traits4
Inflorescencecyme
Seeds per fruit101-1000
Shoot length max1 000 cm
Shoot orientationscandent
03Chemical composition46 compounds
Compounds documented for Smilax aspera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols7
Furostane steroids6
Chalcones5
Spirostane steroids4
Prenyl quinone meroterpenoids2
Documented compounds46 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (25S)-5beta-spirostane-3beta-ol-3-O-alpha-L-rhamnopyranosyl-(1->2)-beta-D-glucopyranosyl-(1->2)-beta-D-glucopyranoside | present | LOTUS | |
| (2R)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2S)-4-[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18R)-16-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3R,4S,5S,6R)-2-[(2S)-4-[(1R,2S,4S,8S,9S,12S,13S,16S,18R)-16-[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-6-en-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S)-5-hydroxy-7-methoxy-6-methyl-2-phenyl-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S,3R,4R,5R,6S)-2-[(2R,3S,4S,5R,6R)-4-hydroxy-2-(hydroxymethyl)-6-[[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18R)-6-methoxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-yl]oxy]-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S,6R)-2-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[[(1R,2S,4S,6R,7S,8R,9S,12S,13S,16S,18R)-6-hydroxy-7,9,13-trimethyl-6-[(3S)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-16-yl]oxy]oxan-3-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5R,6R)-2-[(2R,3R,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1R,2S,4S,5'S,6R,7S,8R,9S,12S,13S,16S,18R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3R,4S,5S,6R)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1R,2S,4S,5'S,6R,7S,8R,9S,12S,13S,16S,18R)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosane-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5S,6R)-2-[(2R)-4-[(1S,2R,4S,6R,7S,8R,9S,12R,13R,16S,18S)-16-[(2S,3S,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-hydroxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icosan-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS |
05DNA & barcoding84 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smilax aspera has left across the world's sequence archives.
At a glance
DNA specimens84
Marker genes4
GenBank sequences10
eDNA detections82
Countries5
The DNA barcodea real sequence read deposited for this species
CGACCGGAAGACCCGCGAACTCGGAACGGACGCCGCCGGAGCGGGCGGGCGCGCCCGTCCCTCCGGCCCGCCGCCCCTCGGGCCTCGGCC …
Smilax aspera haplotype 19 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS9
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Smilax aspera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 070 630 612 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Smilax aspera5.07 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy2× diploid · measured
Chromosome records32–322n range32median32mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3220×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · iber-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MARCHI P. - 1971. Numeri cromosomici per la flora italiana:57-66.. Inform. Bot. Ital. , 3(2): 124-137.
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).
CCDB · fl-europaea — Marchi, 1971
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1987. Cytology of five species of Smilax from south India. Nucleus (Calcutta) 30: 57–60.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1989. Karyomorphology of five south Indian species of Smilax Linn. Cytologia 54: 65–72.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.
CCDB · book-ipcn67-71 — MARCHI, P. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: 124-157.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.
CCDB · book-indian_vol2 — de Carvalho, M.L. 1948; Mehra, P.N. & Malik, C.P. 1961c; Marchi, P. 1971b; Mehra, P.N. &Sachdeva, S.K. 1976a ; Natarajan, G.1978
CCDB · eflora
CCDB · book-atlas-flowering-plants — Carvalho 1948
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1973). Cytotaxonomy of Spanish plants. II. Monocotyledons. Lagascalia 3(2): 147-182.
CCDB · CromoCat 2015 — Marchi, P. (1971a). Numeri cromosomici per la flora italiana: 46-56. Inf. Bot. Ital. 3(1): 82-94.
CCDB · CromoCat 2015 — Natarajan, G. (1978b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 526-531.
CCDB · CromoCat 2015 — Vijayavalli, B. & P. M. Mathew (1990c). Cytotaxonomy of the Liliaceae and Allied Families Continental publishers, Kerala, India.
CCDB · CromoCat 2015 — Vijayavalli, B. & P. M. Mathew. (1987). Cytology of five species of Smilax from south India. Nucleus 30: 57-60
CCDB · CromoCat 2015 — Vijayavalli, B. & P. M. Mathew. (1989). Karyomorphology of five south Indian species of Smilax Linn. Cytologia 54: 65-72
n 167×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 162-182. Cardona, M. A. & J. Contandriopoulos.Lagascalia9(2): 272-284(1980).
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1987. Cytology of five species of Smilax from south India. Nucleus (Calcutta) 30: 57–60.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.
CCDB · ipcn-api-dl — Cardona, M. A. & J. Contandriopoulos. 1980. In Numeros cromosomicos para la flora EspaPSola. 121-182. Lagascalia 9: 249-284.
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1976
CCDB · CromoCat 2015 — Vijayavalli, B. & P. M. Mathew (1990c). Cytotaxonomy of the Liliaceae and Allied Families Continental publishers, Kerala, India.
CCDB · CromoCat 2015 — Vijayavalli, B. & P. M. Mathew. (1987). Cytology of five species of Smilax from south India. Nucleus 30: 57-60
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type95 942 records
Wild obs. + sensor87 203
Museum / vouchered1 778
Cultivated / captive6
Other6 955
Origin
Native4 696
Introduced3
Range
Area of Occupancy AOO87 664 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 36 301≤1 km 9 594≤10 km 21 117>10 km 665
67 677 georeferenced · 19 526 without coordinates
Open the mapobservation + sensor87 203
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 33≤1 km 154≤10 km 204>10 km 6
397 georeferenced · 1 381 without coordinates
Open the institutions mapphysical evidence1 778
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤1 km 1≤10 km 1
2 georeferenced · 4 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions49 of 90 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 495 |
| MAlocation not on record | 143 |
| Sevilla, ES | 92 |
| València, ES | 73 |
| Berlin, DE | 67 |
| BDBClocation not on record | 66 |
| ISAlocation not on record | 58 |
| Barcelona, ES | 56 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 46 |
| LDlocation not on record | 45 |
| Vitoria, ES | 34 |
| BClocation not on record | 32 |
| CICYTEXlocation not on record | 31 |
| GZUlocation not on record | 29 |
| Saint Louis, US | 28 |
| Córdoba, ES | 28 |
| UIBlocation not on record | 27 |
| College of the Atlantic, Museumlocation not on record | 26 |
| Granada, ES | 21 |
| South Kensington, GB | 19 |
| Badajoz, ES | 16 |
| Wlocation not on record | 15 |
| Sevilla, ES | 15 |
| Kew, GB | 14 |
| TAFORI-LSRClocation not on record | 12 |
| Beijing, CN | 11 |
| Alicante, ES | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| JBSlocation not on record | 9 |
| Rishon Le Zion, IL | 9 |
| Moscow State Universitylocation not on record | 9 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 9 |
| MeiseBGlocation not on record | 8 |
| Dresden, DE | 8 |
| Entomological Society of Latvialocation not on record | 7 |
| Salamanca, ES | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Paris, FR | 6 |
| Christchurch, NZ | 6 |
| CJBGlocation not on record | 6 |
| Madrid, ES | 5 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 5 |
| Auckland, NZ | 5 |
| Madrid, ES | 5 |
| Universite de Montpellierlocation not on record | 5 |
| Provincia di Livornolocation not on record | 4 |
| Davis, US | 4 |
| BRNUlocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Copenhagen, DK | 4 |
| Jaén, ES | 4 |
| Karlsruhe, DE | 4 |
| Minia, EG | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Banyoles, ES | 3 |
| Bourges, FR | 3 |
| Dehra Dun, IN | 3 |
| Oskarshamn, SE | 3 |
| National Institute of Biological Resourceslocation not on record | 3 |
| Pondicherry, IN | 2 |
| Stockholm, SE | 2 |
| Monastir, TN | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Clocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Edinburgh, GB | 2 |
| Bronx, US | 2 |
| Coimbra, PT | 2 |
| Uppsala, SE | 2 |
| PRClocation not on record | 1 |
| Arusha, TZ | 1 |
| Chicago, US | 1 |
| Sion, CH | 1 |
| Taipei, TW | 1 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 1 |
| CASlocation not on record | 1 |
| Xiamen, CN | 1 |
| EEZA-CSIClocation not on record | 1 |
| GJOlocation not on record | 1 |
| University of Zagreblocation not on record | 1 |
| Pamplona, ES | 1 |
| EL PASO, US | 1 |
| Québec, CA | 1 |
| Xining, CN | 1 |
| Porrentruy, CH | 1 |
| IPE-CSIClocation not on record | 1 |
| Kunming, CN | 1 |
| JBAlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
90 institutions · 1 725 of 1 778 vouchered records shown · 46 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA82 detections
Where the DNA of Smilax aspera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found82
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 82 detections have coordinates
Open the map4 countries0
Non coniferous evergreen forestscrublandConiferous forestNon coniferous evergreen forests
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 12.9–21.7
Seasonal swing summer↔winter17.2 °C
Max temp (day)20.5 °C 17.1–26.5
Min temp (night)10.4 °C 8.00–15.7
Precipitation40.1 mm/mo 33.4–75.6
Air humidity53.9 % 52.9–61.4
Moisture balance-61.7 mm/mo -122–-16.0
Vapour deficit953 Pa 653–1,155
Wind speed2.90 m/s 1.80–4.00
Cloud cover39.2 % 37.0–41.6
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.