Smelowskia americana

(Regel & Herder) Rydb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Smelowskia

At a glance

Occurrence records936

Data sources10

Biological traits6

DNA specimens24

eDNA detections20

Sources10 archives

Databases and archives Smelowskia americana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility936 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF936 records

Environmental DNA1 datasets · 1 countries20 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Smelowskia americana is a species of Smelowskia known by the common names alpine smelowskia, Siberian smelowskia, and American false candytuft. Native to mountain ranges of western North America including the Olympic Mountains and Cascade Range of Washington and the Rocky Mountains of British Columbia and Alberta south to Colorado, it occurs on rocky outcrops and talus at subalpine and alpine elevations, i.e., from 1300 -, and blooms from late May until early September.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment4

Climatesubalpine or subarctic

Climberself-supporting

Growth formherb

Woodinessnon-woody

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Smelowskia americana has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes5

GenBank sequences10

eDNA detections20

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK802498.1 ↗597 bpUSA · 2013

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATACCTGTCCAAAACAGAACGACCCGCGAACCAACGATCACCACTCTCGGTGGGC …

Smelowskia americana voucher ID:169469 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL1★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Smelowskia americana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records12–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 223×CCDB · book-ipcn67-71 · CCDB · brass

CCDB · book-ipcn67-71 — PACKER, J.G. 1968. In IOPB chromosome number reports XVII. Taxon 17: 285-288.

CCDB · brass — Packer

CCDB · brass — Mulligan

2n 121×CCDB · brass

CCDB · brass — Drury & Rollins

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type936 records

Wild obs. + sensor691

Museum / vouchered245

Range

Area of Occupancy AOO1 968 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 393≤1 km 67≤10 km 36>10 km 18

514 georeferenced · 177 without coordinates

Open the mapobservation + sensor691

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 28≤1 km 51≤10 km 61>10 km 4

144 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence245

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee des Dinosaures d'Esperaza (Aude)location not on record	40
University of Alberta Museumslocation not on record	36
Denver, US	34
Rocky Mountain Biological Laboratorylocation not on record	25
WTUlocation not on record	15
Corvallis, US	11
Wuzhou, CN	11
Durango, US	9
Orem, US	8
Albuquerque, US	6
Flagstaff, US	5
Boise, US	5
DOI/NPS, Colonial National Historical Parklocation not on record	4
Bozeman, US	3
Moscow, US	3
Caldwell, US	3
Pullman, US	3
Bloomington, US	2
Chadron, US	2
Bangkok, TH	1
University of Lethbridgelocation not on record	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
AUAlocation not on record	1
Spearfish, US	1
Pittsburg, US	1
Research Collection of B. A. Bennettlocation not on record	1
St. Paul, US	1
Whitehorse, CA	1
Saint Louis, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
CASlocation not on record	1
Provo, US	1

32 institutions · 238 of 245 vouchered records shown · 7 without an institution code

09Environmental DNA20 detections

Where the DNA of Smelowskia americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map1 country0

common on alpine areasrocky slopefairly common at this altitude. Rust occasio…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 9.10–9.10

Seasonal swing summer↔winter24.6 °C

Max temp (day)15.1 °C

Min temp (night)3.80 °C

Precipitation141 mm/mo

Air humidity56.9 %

Moisture balance21.6 mm/mo

Vapour deficit500 Pa

Wind speed3.20 m/s

Cloud cover35.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)