Skimmia japonica

Thunb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Rutaceae/Skimmia

At a glance

Occurrence records1 351

Data sources9

Biological traits16

DNA specimens1

eDNA detections20

Sources9 archives

Databases and archives Skimmia japonica's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 351 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS38 compounds

Occurrence & distributionGBIF1 351 records

Environmental DNA1 datasets · 3 countries20 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT3.1 Gbp

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max0.5 m

Plant height min0.3 m

Seed mass14 mg

Seed mass max14 mg

Seed mass min14 mg

Life cycle & reproduction5

Deciduousnessevergreen

Flowering endJul

Flowering startJun

Life formshrub

Life spanperennial

Habitat & environment5

Climatetemperate

Climberself-supporting

Growth formshrub

Habitat GIFTforest

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition38 compounds

Compounds documented for Skimmia japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Limonoids13

Simple coumarins6

Furocoumarins6

Quinoline alkaloids4

Furocoumarins $ Simple coumarins3

Documented compounds38 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2S,4S,5S,6S,7S,8S,9R,12R)-6-(hydroxymethyl)-2,10,10-trimethyl-11-oxatricyclo[7.2.1.01,6]dodecane-4,5,7,8,12-pentol	present	LOTUS
11-Oxo-alpha-amyrin	present	NPASS
3-[(1R,2R,5R,6R,7R,10S,11S,14S)-11-(furan-3-yl)-5-(2-hydroxypropan-2-yl)-2,6,10-trimethyl-3,13-dioxo-12,15-dioxatetracyclo[8.5.0.01,14.02,7]pentadecan-6-yl]-3-hydroxypropanoic acid	present	LOTUS
4-Hydroxybenzoic acid	present	NPASS
6-Methoxy-1-methyl-2-phenyl-4(1H)-quinolinone	present	LOTUS
6-methoxy-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,4-dihydrochromen-2-one	present	LOTUS
[(1S,2R,3R,5R,7R,10S,11R,14R,15S)-15-[(2R,3S,5R)-5-[(2S)-3,3-dimethyloxiran-2-yl]-2-hydroxyoxolan-3-yl]-3-hydroxy-2,6,6,10-tetramethyl-7-pentacyclo[12.3.1.01,14.02,11.05,10]octadecanyl] 3-methylbutanoate	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[2-[(2S)-9-hydroxy-7-oxo-2,3-dihydrofuro[3,2-g]chromen-2-yl]propan-2-yloxy]oxan-2-yl]methyl (E)-3-(4-hydroxy-3,5-dimethoxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[2-[(2S)-9-hydroxy-7-oxo-2,3-dihydrofuro[3,2-g]chromen-2-yl]propan-2-yloxy]oxan-2-yl]methyl (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
Bergapten	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Skimmia japonica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections20

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLLC693286.1 ↗573 bpJapan · 2011

ACGT

AAGATTATAAATTGACTTATTATACTCCAGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAG …

Skimmia japonica var. japonica TF<JPN>:NOT_16 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL9

plant barcode

06Genome at a glanceGoaT

The complete instruction manual Skimmia japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 129 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Skimmia japonica3.13 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

08Occurrence & distribution

Record type1 351 records

Wild obs. + sensor820

Museum / vouchered514

Cultivated / captive17

Origin

Native5

Range

Area of Occupancy AOO2 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 369≤1 km 187≤10 km 156>10 km 9

721 georeferenced · 99 without coordinates

Open the mapobservation + sensor820

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 10

15 georeferenced · 499 without coordinates

Open the institutions mapphysical evidence514

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 10

10 georeferenced · 7 without coordinates

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odawara, JP	80
Bando, JP	77
Sanda, JP	51
Chiba, JP	38
Nagano City, JP	37
Nagatoro-machi, Chichibu-gun, JP	36
FFPRIlocation not on record	29
Osaka, JP	28
Sagamihara, JP	15
WTUlocation not on record	8
Kew, GB	6
Chengdu, CN	6
TAIElocation not on record	5
KURAlocation not on record	5
Shanghai, CN	5
University of Stellenboschlocation not on record	5
SLU Artdatabankenlocation not on record	4
Zhejiang Universitylocation not on record	3
Akita Prefectural Museumlocation not on record	3
KOMlocation not on record	3
Saint Louis, US	3
Edinburgh, GB	3
MeiseBGlocation not on record	2
LDlocation not on record	2
Taipei, TW	2
Taipei, TW	2
Beijing, CN	2
Bronx, US	2
Taipei, TW	2
Canadian Department of Agriculturelocation not on record	2
Tomioka, JP	2
Yangling, CN	2
Wlocation not on record	1
“Manash Kozybayev North Kazakhstan University" NPLClocation not on record	1
Nijmegen, NL	1
Wuhan, CN	1
Rotorua, NZ	1
Podgorica, ME	1
Vancouver, CA	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
JBAlocation not on record	1
Vitoria, ES	1
South Kensington, GB	1
Angwin, US	1
Xiamen, CN	1
Paris, FR	1
Chengdu, CN	1

47 institutions · 485 of 514 vouchered records shown · 28 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA20 detections

Where the DNA of Skimmia japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found20

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 20 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 12.3–24.2

Seasonal swing summer↔winter23.3 °C

Max temp (day)20.8 °C 15.0–27.1

Min temp (night)14.8 °C 7.50–20.4

Precipitation215 mm/mo 152–279

Air humidity65.1 % 59.4–67.9

Moisture balance108 mm/mo 21.9–257

Vapour deficit778 Pa 512–1,002

Wind speed2.40 m/s 1.70–5.20

Cloud cover41.3 % 34.8–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Skimmia japonica

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction5

Habitat & environment5

Physiology & chemistry1

Compound class profile5 classes

Documented compounds38 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 351 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions31 of 47 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 351 records