Skeletocutis stellae

(Pilát) Jean Keller · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Incrustoporiaceae/Skeletocutis

At a glance

Occurrence records2 636

Data sources8

Biological traits0

DNA specimens0

eDNA detections1

Sources8 archives

Databases and archives Skeletocutis stellae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 636 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 636 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Skeletocutis stellae is a species of fungus belonging to the family Polyporaceae. It is native to Eurasia and Northern America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Skeletocutis stellae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

eDNA detections1

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPV796036.1 ↗431 bpFinland · 2019

ACGT

CGCTATTAATAACGCATGAAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAAT …

Skeletocutis stellae strain FBCC2659 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type2 636 records

Wild obs. + sensor1 540

Museum / vouchered1 096

Range

Area of Occupancy AOO5 888 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 1 247≤1 km 198≤10 km 55>10 km 6

1 506 georeferenced · 34 without coordinates

Open the mapobservation + sensor1 540

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 384≤1 km 156≤10 km 129>10 km 28

697 georeferenced · 399 without coordinates

Open the institutions mapphysical evidence1 096

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	354
Metsähallituslocation not on record	150
Olocation not on record	124
SLU Artdatabankenlocation not on record	87
Philadelphia, US	52
Turku, FI	49
Joensuu, FI	43
Kuopio, FI	42
Tartu, EE	36
Oulu, FI	19
Jyväskylä, FI	15
Stockholm, SE	14
Uppsala, SE	10
BioFokuslocation not on record	8
Bronx, US	8
Helsinki, FI	3
Mlocation not on record	3
TFC Miclocation not on record	3
WU-MYClocation not on record	3
Görlitz, DE	3
Umeå Universitylocation not on record	3
Toronto, CA	3
Trondheim, NO	2
Göteborg, SE	2
UNINE:NEUlocation not on record	1
TROMlocation not on record	1
San Sebastián, ES	1
TENN-Flocation not on record	1
Zürich, CH	1
DPIlocation not on record	1
TUR-Alocation not on record	1
BRNUlocation not on record	1

32 institutions · 1 044 of 1 096 vouchered records shown · 52 without an institution code

09Environmental DNA1 detections

Where the DNA of Skeletocutis stellae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 13.2–13.2

Seasonal swing summer↔winter44.2 °C

Max temp (day)17.7 °C

Min temp (night)7.50 °C

Precipitation124 mm/mo

Air humidity56.5 %

Moisture balance14.6 mm/mo

Vapour deficit664 Pa

Wind speed2.00 m/s

Cloud cover37.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Skeletocutis stellae

At a glance

Sources8 archives

At a glance

Record type2 636 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 636 records