Skeletocutis kuehneri

A.David · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Incrustoporiaceae/Skeletocutis

At a glance

Occurrence records1 127

Data sources8

Biological traits0

DNA specimens2

eDNA detections41

Sources8 archives

Databases and archives Skeletocutis kuehneri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 127 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 127 records

Environmental DNA3 datasets · 11 countries41 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Skeletocutis kuehneri is a species of poroid crust fungus in the family Polyporaceae. It was described as new to science by Alix David in 1982. The holotype was collected in France, where it was found growing on pine. It has been recorded from Norway, Finland, and Sweden, although it is rare in the Nordic countries. The fungus is a successor species, and prefers growing on pine that has been previously degraded by Trichaptum fungi, particularly T. abietinum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Skeletocutis kuehneri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections41

Countries11

The DNA barcodea real sequence read deposited for this species

ITSMT924798.1 ↗265 bpChina · 2016

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTATTGACAGGGTTGTCGCTGGCCTTTACCGGCATGTG …

Skeletocutis kuehneri isolate OTU0472 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type1 127 records

Wild obs. + sensor342

Museum / vouchered785

Range

Area of Occupancy AOO3 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 250≤1 km 17≤10 km 47>10 km 3

317 georeferenced · 25 without coordinates

Open the mapobservation + sensor342

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 351≤1 km 56≤10 km 55>10 km 10

472 georeferenced · 313 without coordinates

Open the institutions mapphysical evidence785

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	165
Olocation not on record	153
Metsähallituslocation not on record	108
Philadelphia, US	59
Kuopio, FI	55
SLU Artdatabankenlocation not on record	26
Joensuu, FI	25
BioFokuslocation not on record	15
Görlitz, DE	13
Copenhagen, DK	13
Jyväskylä, FI	12
Oulu, FI	9
Tartu, EE	8
Mlocation not on record	5
Zürich, CH	5
Uppsala, SE	4
Umeå Universitylocation not on record	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
nsnflocation not on record	3
Salamanca, ES	3
Kew, GB	2
University of the Basque Country (UPV/EHU)location not on record	2
Rovaniemi, FI	2
UNINE:NEUlocation not on record	1
JA-CAGPDS-CAMlocation not on record	1
UFSClocation not on record	1
Helsinki, FI	1
University of Oslo, Natural History Museumlocation not on record	1
Turku, FI	1
Stockholm, SE	1
San Sebastián, ES	1
Gijón, ES	1
Göteborg, SE	1

33 institutions · 704 of 785 vouchered records shown · 81 without an institution code

09Environmental DNA41 detections

Where the DNA of Skeletocutis kuehneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys3

Countries11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map11 countries0

Old spruce dominated forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 6.40–19.7

Seasonal swing summer↔winter20.0 °C

Max temp (day)19.2 °C 8.00–24.4

Min temp (night)10.4 °C 3.50–14.0

Precipitation99.7 mm/mo 62.4–177

Air humidity60.0 % 56.6–67.7

Moisture balance23.7 mm/mo -52.2–66.3

Vapour deficit689 Pa 303–1,005

Wind speed2.60 m/s 1.80–3.90

Cloud cover40.1 % 33.0–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Skeletocutis kuehneri

At a glance

Sources8 archives

At a glance

Record type1 127 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 127 records